Description :
From Genome Similarity Track
Location :
Scaffold_1545:3976- 6686
Transcript NameFunction/comments
Phyag_g10926conserved hypothetical protein

Sequence
2710 bases(100 bases per row)
TTTACGCACGGTTGGTAAATGAGTGTGCATCCACAGAGACGACTCGCTGTGTTGCATGGATACCTTTCAGTGAGCTGGTTGGCAATCTGAACGTCTACCT
GCGTCGGCGACTGCTACCGCTGCTATTTGTCTGCTCAAGACGGTTCTTGTCGAACGCGatatgctgctgcaaaatgctGCTCAAAATCAGCTCTGGGGAG
TAAATCCGCTGCGGGTTCGcctgcgccagcgccttctgaACCGAGGCCGTGGCCAGCGCTACTTCGCTTGtgatcaccacgtcgttcgGGCCGGCGCAGC
CCTTGGTCGCGGCAGTTCCGCCGGCGCACTCCACGATCTTCACCAGGTCCTTCACTGGCGGCAACACCGACTTGTGGTTGGTGATGAATACCTGATGGCC
GGAAaagagctgctgtcgctgctttgGGGTAAAGTCGTACATAGTCTTTAGCAGATCAAACTGCCACTTCGTTTCAGCTTTTGAATCCTTCAAGCAGTGT
GCCCGCTCGTAGATAGGAGCGCCCACGCGAGCTGACTCGTCCAGCCATCGCACGTCTAGCACGTGCGCACAGCGTGAGATCCCGCAAAGCAGCTTCACGG
TTCGCTTCAGTTGGTTCTTCGGGGCTAGAATGTGCGTTGCCTTTTCGATGTCTTCCTCGTAGACAGCACCCGCAATTGAATCAATCTTCTTCCGGATCGC
GGCGGTGGGCTCAACACCAGTGAGGATAATCCGCACTTCCTGGGTTTTCGGTTCGTCTTCACTGAAGACGTCAGCAGGGGCTTCATTGGCAGGAAGCTGA
GTAACGTCAATGTCACTCGTCGAAGCAGACGCGTCTGTTGGAGCACTTGGGCTTGGCTGCGTTGGAATCAGGGCAGAATCGTTGGGGTCTTTTGACTTCC
TCTTCAGCCATCTTCTCTTCGGAGTTTTCATAGGTGGCGAGACAACAGTGCCAAAACCGTCTTTCCCTTCCGCGGTAGTCGTAATTGACGGCCGAATTGA
CTTGTCTGGTGATCGCCtggatttcttcttcgccggAGGTGCATCAGCTTCTTCCCCTTCCACACAGATCGTTGTAGAACTCCTTTCCAGTTCACCACAT
TCTTCGTCGGTCTTGTCACCTGGTTTAGAACCACTAGAGCCTGCAGGACTTGAACTTGAAAGGGATTCCCgtttctcctccaccaatGTAGTTGagcttt
cgtcgctgtcggatGCAACCTTAAGCTTTCGCTTCTTCCGAGCAAGTTCACTCCCTTCCCTGCTGCCACTGCGCGCATtagcttcttcctcttccatcTC
TTGCCGCTCTCTCTTTTCCCTTTCTGCTCGCCTTGCCGCAATCTGCGCACCTTCGACCTCTTTCCACACTTGATCAAACCAGAAATCGATTCTAgttctc
ttcttcgacacGAGTGTGAGATTTCCTGCAGATCCATTGGAAATTACCAAGCTCCACTCCTTGTCCCCTCGTGGCTGTTCACCGATCTCGATCTCAGGGG
CGTGAGTATCGAGATTGAGTAAAGCTGAATGTCCTCTCCACCCGTCGAGTTTGAAAACTAGAAGCCATCTAGCATACAAAACAATTTCAACCAATTCCCA
CTGAGACTTGCTTGAGTCCGAGTCCTTGCCAGGTGCCATCCAGAATATCCCAGGCAGATGATCATCGTAAAACGATGCAAACTCTGTCAGAATAGCATCC
TTTTCTGCAAGCTGCGTTGTAATCTTTTCAACTACAGGAAGCTCGCCAATCCTCCGGTCTTGGTGAAGCGCTTCAGTCCGCGATCCATTCATTTCCAGAA
AGCCCCCAATAACATCAGCCCAACGTTGACAGTCCATTGCATCTCTCCAGGCAAATATGAGTGTTGTGTCTCGCATAAGTAGCGCCAACGCACGTGCTTC
CTCTGAAGACTCGAGCATCGGGACGCTAGCTGGAACAGCTTCCAGAAAAGCCGCGTCTTGTTTCAGCTGTATGCAATGAAGGATCGCAAACGAAGTTCCT
GAATCCGTGTCCTGCCGCTTACTACAAACCAAAGTCCCGTCCTCAAAGCAATGCGCGTATAACTCTTCTGGCTGGAACGGTCCCGTGTGGTTGGTAGTCA
CTGATCCAGCTTCACTGCAATCGATTTGAGACCTCGTCGACAGGAACACTTCTCCGTGAAGCAGTAACTTGTTGCTGGATAAATCATTGAAAGCCTCAGC
TCCGTCACCGTGGAAGCAGGCCTGCAGCGCAATTAATTCTTGTTCCTCGCGTGCGTCAGCCTTGGCGAGATGAATATAATTTTTGTTTTCCTGGACAATA
TGCATCAATTGAGGTGCGTAGTTGAGATTTTCTTCAACGCCTGCATCGCTGTCGTTACTTATGGATCCATCTCCGCCACCCTCTGAAAGGGTCGTGCTCA
GCGCTTGGACAAACTCCACCAACGCATTAAACCGCTCCAGCGGACGAGACATCAGCATTGCAGCAGTTAACTGCTGCTTTTCCAGATATTTCTTCAAAAT
ATGTCCGTCTTGATCCTCTCCGTCTGCCTTTATTAATGCTGCTTCCAGCGCTTCTTGGGTTGCTTCACGTCTGCTGAAAAGCTGTGCGTACAGGACGCGG
AGGACGCTCAGCATGTCGCTTAGAATctccacgaagctgctgcacttcccGTCAACTGACTTAGCATCTCCCCGCGCTGGAGACTCTGCGTACGGTTTCA
ATTTGCCCTG