Description :
From Genome Similarity Track
Location :
contig_21:397592- 399603
Transcript NameFunction/comments
g3891.t1hypothetical protein AM588_10005190

Sequence
2011 bases(100 bases per row)
GTGGGCTCATACCTCACGAGTCCGTTCAACAACGGACCCGTGAACGGCACGTACATGTGGTCGGCAGAGGAGTGGCGCGAGGTGGTCACAAGGATCCAGG
ACATCACCATGGAGGAGAACGGTGGCCACCCGATGGTGTACGGCGTCGACTCGGTGCACGGCGCCATCTTCGTGAAGGACGCCGTGCTGTTCGGCCAGCA
GATCAACGGCGGCGCTTCGTTCAACCCCGACCTTGTGTACGAACAGGGCCGCATCACGGGCCGCGACACGGAGGCATCGGGCGTACCATGGGTGTTCGGC
CCCATTCTCGGCATCTCGCGCAACCCGCTGTGGGCCAGAACGTTTGAGACGTTCGGCGAGGACCCGCACCTGAACTCCATTATGGGCGACGCCATCATCC
GCGGCCTGCAGAGCAACAACCACACGGCCGCTTGCATGAAACACTGGATAGTTTATCCTAAGACGCCTTCGGGCCACGACAAGGACGCCGTGACGGTGTC
GGACTACGACATGATGAACTACTTCTTCCCGCCCTTCAAGGCCGCCGTGGACGCCGGCGTGATCAGCGCCATGGAGAACTACATCTCCATCAACGGCGTG
CCCACCGTGTCGAACACCAAGCTCATGAACGCGCTGCTGCGCGACGACCTGGGCTTCGACGGCATGATGGTGACGGACTACGCCGAGATCAACCAGCTGA
CCGACTTTCACCGCACCGCGCGCAACGAGACCGAGGCGACGCGCATCTCACTCACGCGCGCGTCCGTGGACATGAGCATGGTGGCGCAGGACACGAGCTT
CTACAACGGCACGAAGGCGCTGCTGGAGCAGAGCCCGCAGTTCCGCGAGCGCCTCAAAGCGTCGGCCCGCCGCGTGGTCAAGATGAAGCTGCAGTGGGTC
TGTACGAGACGCCGGTGCCCGGGGAGGAGAACCTGGCACTCATCGGCAACGACGACGATATCTCGGCGGCACTGGAGCTGGCGCGCGAGTCCATCGTGCT
GCTGCAGAACAACGACAGCACGCTCCCTATCGCCGACGACGCGTCGGTGTTCCTCACGGGCTTCACTGCCGACAACATCGGCCGCATGTGCGGCGGATGG
ACGATCGCGTGGCAGGGCTACAGCGACCAGGATCACCTTCTCACGAAGGGCATCACGGTCAAGTCGGCCATGGAGACGCTCGTCGGCAACGACAGCTTCG
CCTTCTTCAACGGGTTGCACCCGAACGGGTCGTACTCGGAGGCGGACATGGCCACAGCCAAGGAGATGGCTGGCAAGGCCGAGTACACCATCGCCGTGAT
CGGCGAAGACACGTACGCCGAGAAGCCTGGTGACATCGACGACTTGGCGTTGCCCGCCGGTCAGATTGAATACGTGAAGGAGCTGGCGTCCACGGGGACC
AAGGTCATTCTGGTGCTGTTTGAGGGTCGTCCGCGTCTGCTCGGCGACCTCCCCGAGAACGTGCACGCCGTGGTGAACGGCCTATTGGCCTGCGAACTGG
GCGGCCAAGCCATGGCCGAGATCATCTACGGCAAGGTGAACCCGAGCGGCCGCATGCCGATCACGTACCCGAAGGACCAGGCCAACATCCAGCTGACGTA
CAACCACCCCGTGACGAGCATGTGCCAGACGCAGGAGTCCAGCAGCGCCTACTACTGCGAGAACCAATGGGACTTCGGCACGGGTCTCAGTTACACCGAG
TTCTCCTACTCGGAGGTGCGTCTCAGCCGCAGCGTCGTGGAGGTCTCGACCGAGGACGTCGTGGTGTCTGTGGACGTGACAAACTCTGGCAGCGTGGCCG
GCAAAGAGACCGTGATGCTGTTCCTCATTCAGCCGTTCAACTCGCTGAACGTGCCGGAGATGAAGCAGCTCAAGAAGTTCTCCAAGATCAGCCTCGAGCC
CGGCCAGACGCAGAACGTCGAGTTCACGCTCACGGCGGATGACTGGAGCGTGTACTACCCGCAGGTGGGCCACGGCCTCAAGAAGGTGGCCGAGGACTGC
GACTTCGTGGT