Description :
From Genome Similarity Track
Location :
Scaffold_146:39754- 46456
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.7Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.16Calcium-dependent protein kinase

Sequence
6702 bases(100 bases per row)
TCTAATAACAAGTTCTCGGGCTTGAGGTCGCGATGCACGATGCGGTGAAAaTGACAATACTCGACGCCCGagATGATCTGGTGGAAAAaGTGGCGCGCCT
CCTCGGGTGATAACTGCACGCATACACAGAGAAAAAAATCAGTCGACGCTTGAACGCAATTAGTGACTGGGTATCTACTTACGCGGCCCTTGGAGACGAT
ATAGTCGAACAACTCGCCACCTGCCACATACTCGAGCACCATGAAgATGTCGGTGGgCGTGTCAATAACCTCGTAGAGACGGATGATATGCGGATGACGC
ATCTTGCGCAGTAACGAGATCTCGCGCCGGACCTTTTcGCCCATGTCTAGGCTGCGGATCTTGTTGCGATTAAGGATCTTGATCGCCACCTTGTGGCCCG
TGATCTCATGCTCAGCGACTGCACCACGCCACGCTCCGTCAGTCGCGTTTCTCACCCTCACTGGCACCTGCCAGGCGCCTGAGCCTCTTTACTTACGCTT
CACCTTGCCGAAGGAGCCGATTCCGAGCGTCTTGCCGAGGCGATACGGCCCCAGTTTGATCGGCACGTCGCTCATCTTGGCACTTCCGGTCCCTCGTCTC
CGCTTGGGTCTTGCGCAAAGGAAaCGAAGAaGGAACGGCAAAACCGAaCGgaTACCGGTTtGGACGGGgCGTAGCCACTAAACCGGTACTCACCTCAGTT
tCGTCGACGAAGTTCAAGGACTTCTAAATCAGTAAAAaGCATCCAGTGAACTGAAGTCAGTGGATgTGTGAaGCACGGCAGACATGAGAAATCCGATGGA
GCACcgAGACATTGCGACTTGGATTCTACTGTAGTGGTCGTCGCACAGACACCGCGTACTGTACAGAATGCAAGGaGATCGCTGTGCACCATACACTGGC
CGGATGTCGGCGATTGTTCAACGAATTCAGTGTCGCGTAGCACCACATGCCACCAGCCGAATCCCCATTGCAAAATGATACAaCAGTCGCGATTACAGTA
TGCAACGTTGACgAGGAGGGTTTGCAATGCGCGATGGTCAAAGCACTTGGGCTAGAGGCAGCGTCACGAAGCTCCGACATGAGCCTTGAAGCTCCATGTC
ATCTATGATCTGTTcAGTAGCGCGCCCCATGGCTTTGCCGCTCACTTTTCCATGGTCGTCTTGGTCGGATCTTGAACGACAAGGGGGgATGAGGGAGGGG
ctGTTAAAAGGGTGAGTGTGACAATCTTCGCATGACTGAGAAaCCGAGAGCTTATGTGACTGGGTACAAAGACCGCGACAGCCCCACTGCTGCAGTTGGG
CCGCAGCCACTGAGTGACGCTGATCCCATGGCGAAATTTGGTCGGCGTCGTCGCTTCCACGTGTGCCGGGTTgTTCAAAGTGCCGATGCTGTAATGTGGA
AGTtCTTCcTGCTAAaGgTCtCTCTTGGgTTCGTTCCAATAGTAGATGAGAGGAAGAGATGGAGGCAAGGCGCCAAGCGACGCAGGTTCTTTGGGGTCGC
GGGCAATGTCACGTGCGGCACGGTGGTCCGACTCCTTCTCTTGAaGGCGACGCAAGTGACGCCAGTCAAGTCAAgtATCTGCCAACAGTCATGGATGTAC
CTAGTTCCCGTATATATCGGATTACACAGGCTAtACCAAAGCAAATCAATGTGGCATAGATATGAAACTGATGAAACATCCTAATGAGGGTATGTAAATC
CACAaTTCGTCGGTTTTGACAGctGACATTTGCCGAGTTTTTGTTGACATCCCTGGAGTTATCGAGGTTTTTTGCACcTTAAAAGTTGGCAGGGCTAGGG
CGCAGCCATCACTCCTCCTcTtCGGCTCGTCTGCGCCCTGGGTCTGCTCCTCCGCGTCTTGGTCTGGCTCATGGAAGATGGTGCCGCGTCGCTGACGATG
GCTCCTCCTCCGCGCGTCCGTGCCCGATGCCCAGCCATTCCTCGATATTCGCTGCGATCTCCAGCGTCTGCTCCTCGCGTAATCGCCGCACGCAAGCAGC
CGCTGACGTGCGCCGCATTCCGCCAAATCCATCACCCTGCACGCTGCCggAcgCCTGCCCACCGAGTGCACTTCTgCTTCCATCAGCGAGCACGCCACTC
GCGCCATGCTCCGTCACGCCAACTACGCGCCTGAGATGACGACGCCGTCGTtCGCCGCGTCCGCCGTCCCGACCATGCCGCGCACGACCGAAGTGCTCTG
GAACGGCGAGTCGTCGCTGCCGTTCACGCTCAAGCGCAAGCGCAATGGCGCCATCCTCGTGACCAAGATGAAGGACAAACCGACGCCTCCACGTGACCTG
CGGCTGGGAAgCGAGCTCAAGCTCGTGGGCGGTTTTCCtGTCGGACAGCTCACCCTGAGTGAGGTGAAGAAGGTCATGTTGCACGCCCCCAAACCCGTGA
GCCTTGTCTTCCTCAACCACGACGACGTCGTGCTCGACAATATGAGCTTCCTCAGCGAAGAGCGCGGATCGTTTGAGAATGAATTCACATACGAGTACCA
GTATGAACAAGCAGAGCTGTACCCTCCGCTGCGTGAGAcTAGCGAGTGGAGCTACGATATCGCCACGCGACAGCTGCACTCGTGCAGTGCGCCACCAATG
TTCCACGACCACGAGAGTCTGTTcgACAGCTCCTCGTCCGTGTTCGACTCGTCGCgTTCGGTCTTCCGGACGATGTCCAGTACGAGAAGTACAGCCACTG
AGAGCGGTCTCAGCAGCACGCGGCGGCGTCGTCGCTCGCCTGATGCTGGAAGTGAACCTCAGCCTCCCCGCAAGGTCTCGCGGCTCAAGCTCGCACTCGA
ACGCATGAACCAGCTGCTGAACCGTCCCGTGCGCCGCTCGGGATTGAATATTGCCGCTGGGAAGAGCATCGTCGTGTAGAGAGCGCCTGcAATATTACTA
AGTTATTAAGCAGCCAATGCTATCATGACTGTGCTCATGAGaGACCCATTCGAGGCGCCAGCCGTCTCGCGTAGTGCTCATACGCTCGTAGTTGGATATG
CAGCATGGCCAGAAACTCCTCGCGGTCGATAAACCCATCGCCATTAAGATCTGCGTGTTGGAAACAGCGCTTAACATCGCTTCGAAACGAGTAGCGGAAG
CGCGAATCGTCAACAAAGGGGGCAAGTCGCGCCAAGTCGTCGAGCGTCAGTTGGCCATCGCCGTCCTGGTCCAAGGAATCGAACACTTGGGTGACGATGC
CACTCCAaCgaTCAGGgcACTCGCGTTGGATCACCGACCAGTCCAACAACGCTGCACAGAACTCGTCTATGGACAAGTACCCGTCGCCGTCGAGATCGAG
ACCACGAAGAAAGCTCTTGACTTCGCCCTGCGTGAGGCGATACCCAGCGTTCGTTAAGTAGGTGCCGAACTCTGCGATACCAACTTGAGTACTGCCATGC
CGAGAGAGCTCCGTGAAGAGCACGACGATGTGCTCCTTCACTGCCAACGGCAGAAGACGAGCAATCTCCGTGAAAACGGCTTGTTGGAAGCTGTTGAGGG
AGCGGTAAAGTTGAAGCCGTTGAACCATCGTGCCATTTAGGTGTGCTGGAGAAGCCGACAGCTCATCTTGGCTGTGAGTGAACGAATGCCGGAGGATCCA
AGGATGCTGAAGTGCCTGTTCAGCAaTTATCCGCTTGTTCAcGTCCCTAGTGAGGAGCTGCTGGACGaGATCGATGGCGTCTGCAGAGATATGGGACCAA
GGAGCGGAAGTGAAGTCAACaTCTTCCATCATGATACGCTCGTCCAGGAGATCACCTTCGAAGGGGAATCTTCCCGCCAGCAAGCGATAGAGAATGACAC
CGCAACTCCACATATCAGATGGGAACGAATAGCCGTCCTTGGAACGGCTTAGCACTTCCGGCGCcGTGTAAAGAGGGGTGCCACGCACTTCATGAAGCGT
TTCCCcTTCCTTGAGGAATGAGGCGCCTCCAAAGTCTGTGAGTTTGAGTGGCGAGGTATCTTTCGAGTCAGCGAAGAGGAAGTTCTCGAGTTTGAGGTCG
CCATGGAGAATCCGTAGGAGGTGGCACTGCCATACAACATGCAAGATGTCGGTCATGTACATCGCCACGAGCGGTTCGTTATGCTCGTGCTTGGACTGCG
AGAGACGAGCGAAGGCGTCTCCTCCAACGCAGTGCTCCATGACCAAATAGACACTCTCGTCATCTTCATAcGCCCCGAAGAAATGCACGACGTTGAGCGt
CcGCCCAATAGCACCATCATGCGGCCTTCTTGCTGGAGCGCCTGGTAGTCGGCGAGATTCACGACACGTGTCTTGGGAATGATCTTGACTGCAAGGTCGA
GATCCGAGTGCTCGTCCATAGCAACCGCGCGGTGCACTCGACCAAACGCGCCTTCACCCAGCAGCTCCGCGACCTGGTACTTGGTCTGGAAgTCTCGTGG
CAAGTGGAAgTCGATCTCACTGGGGGTTGTGAAGTAAGACGCCGTCTCGAGCGCCAGCCGTTGCAGCACCGGCACTGCATGCAGCTTCTCCAGCAGAGGA
CGCCACGCGCGCCGCACGCTGCCAAACTGAGCGGCCTCTGCAGCCGCcACTGAGGgCGCATTCGGCACGCGGCTGAACGACGACGACGTCGCTTCACGCG
TGTCTGTCGGGCGGCGTGCCACATCCGTGAGCAGTGCGCGCGCCTGGCGAGGGCGCaGgCGCCTGCATTGGTTCCATAGGACGCTGTGCATGGGGGgAGT
CACGAGAGGCGTCGCAGTCACAGAGCGGAGTGCTGGCGACGGCCCGACGCATGAACCAGATGACACACGATGCTGAAACGCCAGACGAACGCTTTGGCGC
ACGTCAACCGACAATAGGACCCCAGGGGAGACTAAAGCAGTCACCGATTCTAACACGTCACAGTTTTACTAAACGCACGTCATGGCTACATGAGACTAAA
TGACTTGGTTTTGCACAACGTCGATCGCCTCGGCGGTCGTCGACTGcGTGGTAaTGGGCTCTGCACCAGCAGCAGATCGCGTCGtggCTTCTtGTCTTCT
CTGGTGgATCACACTACCGCTAATGCGGgTgCTGGCAGgAGAGAGGAGGAACAgAaTCGTGTGCAGCAGCTCCAGCTCCTGCTCGGCACTGGCTTCGCTT
GTGTCATTGCCGCTTTGCTCCACCACAATGCAGTTCACTTGCACCTGAGACGCCCGCAGATCGTTCGATAGCGATTTGGTCATCACTTCAATTGCAGCAC
AATTCATACTTGTCCGACTGCCAGACGAATATAAGGAGTCAGCCATTCTCAACACGGAGACAGCTACACTGAAAAAAAaaCTCACACGTTGTCCGACTGC
GTCGTGATGTTCACAATAGCACTTCGTCCGCCTCGCTGCATGCAGGTAGAACTGAATGCCTGACAAATCTCCAGTATGCGATTCCTGCTTATGCGTGACG
ACACTGTCAGATACATCATGTCGTGACGACGATCAGACACACACTTACGCGCTCGAAGATATCGATTCATCGACATTGCTCTTGCTCCTTTCTCTGTTTG
CACCTGCAGCATCGCTCAAaGACGCTGCATCGTtCTTTTTCGAGTCACTTTCCTCGCCAACAAAGTTGATAAGGAAGTCGACCCTcTCGAACTTGGAAGC
GATTGACCGAGTCCATTCGTCAATCTGGGgACGGgTATGCAATGAACAGAACAAaGGCAGCATCACGCCGCGTGGTGGTTCAACACCCTCAGTATTGTGG
AGCTGGGCTAGGTAGCTAGCTGCGAAGGCCTCTGTCGATTCCTGGTCACTAAATCGTATCCAGTTAGCATCGATGCAGACGCCcAAACAAAGAGCATGAA
AGTATaCTTACGCGAAGgTGACCAGAaCATTTGCACCCATCAGCCACAAATTTGACGCAGCACGGGCAATGGATGGGCGCTCACCGCCAGTTATGACCAC
CTGAAAGATCGACGATGTCAGCACTCATTACTACCGCTCCTCGCTCGTCTACGAaCCATTttGTCTGCGAGCGCACCGCGCCATTGAGCAAATCCCACTG
GGCCAAtGTAGGACATAAGAGCTGCGTGAAGCAGTTCGCCGAACGCGGCTAAGGGCCCTCGCTGGACTGGTTCCACAGGACTTGGAGGAACTGGTGCATT
TGCCAACATCATTGGCGTTGCGACAACACCGTCACGACCATTTCCATTGGACTTGGCTCGCTTCCGTCGGTTCTCCACATCTGAGACGTCAGATGCGTCT
CTCATATTTCTGTATGgAAGGCCTGCAGTGACATTGACAGTTGCTTGAGCAGGCATCATGAAATCGTCGTGACCAAAAGTCCGCTTCTGGGCTTGTAGCT
GCAGCTCACTGTGTGCgTGGGCAGTACCAGGTGCCAAGGTTGCCTGCATGTTACTGTACAGCCCAGAGCTGATCTCGCTCCGTACGTTGCATCTCCCTTC
GCGCATGTTTTGAAGAAAAATCTGCACGGCCAGATCTCCTTCAGCCTCCCGCTTTTGCTTCAACAGCAACATGAACTCTGGGTGCTTGCTCATCAAGTga
TTCTCAATGCGTCCGCGTCGGCAATTAAGTCGACTCCAGATCTTCATCACATCTCGATTGGAATGCGGGTCATCGCACAGCATGCACACAATCACGTCAt
GCGCATTGGCATCGTCGACAGGCTTCCCATCATCTCCCACAAGGTTCGCAGACTTGAGCGCAGCAAAGCTCGCGGCATCCAGTGCGCTGTCAGGTAACGT
CT