Description :
From Genome Similarity Track
Location :
Scaffold_157:39746- 48870
Transcript NameFunction/comments
Phyta_totarag4776hypothetical protein

Sequence
9124 bases(100 bases per row)
CTCTACTCGGCACCAGGACGAAGCACCTTGGTGGGAcgcactgctgcagatgtCGAGCCCTTGAGAACAGAGTGTTTTCGCTTACGCATCTGCTTTGTTC
GACGCTTCTGCTCGTTCTTATGCATCCGCCGCTGGGCAGCACGCTGCGGGTCGGACACGGCTTCAGTACGACGCTGGAGTTTGCGTGCGGCGCGACGTGC
CGCCGTCTTCCTCTGTACGAATGAGTACGCCTCCAAGAACGGCGTCGCTcccagcttctgctccagaagctgcagcacttcctgcGCCATTAATGAGCTC
TCAGGCGGCGTCACAGGCTCCGGCGTAGGACCACTTCTCCGGTTCTTGTGGCGgttgcgctgctgttgctgtagcaGCACTTGCTCCTGCTGAGCCTGTA
GTTCCTCTAGCTTGCTCGAAGCGCGATACAGAGGGTTGATGATTTGCACGACGTACTTCTGAGCAAAAGCAGTGTCGCGGCTGTGCAGCAGTGCAGCGAA
CAGCTTGAACACTACAGCCTGCACCTCGTtactgcagctcgagccACGAGCCACATACGAGAGCCGGGTAAGCAGCCAACCCATGGGCGTACGCGACTTG
GCGCGCTCttcgtccttctcctgctcctcgcgacgctgcagttcctcttcgtcttccttctcgtcggTCTTCTCATCctcaccagcagcggcttcttctg
cttcttctgcttcttcatcgttttcttcctcagcttcagcttcgacagtAGCTTTTGCATCCACCTCGTCACTGGCCAAGGCGTCGGCAGCCGCAGCAGT
CACATCCTGCGGAATGTCCGTGGTCTCAAGCGCTTCGCACAAGAACGGCAGCGCTGTGAGCACTTCGTTAGCCAGCTCATCGTTCAGTGCCGGCGCTccc
agcaacttgcagaaCGCACTAGCCCAAGCAAACAGACGGCCAGGACGCTGCAGGTACAGTGCACCGTTGTGCAGCCGCTCGAGGGCATCCCCAGACACAC
GCTTCACTGGAGCCGCAAAAGCAAGCGTACAtgcttgacgacgacgtAAGTACGACGTCAAGAGCCGAGTCGCACCAAGGCGCACCCATGGGTGGgggta
ctgcagcagcggcagcagcacaacatccaagaagttcttcgccggcttcgtctcctccagccACAGTTCATAGGGGCCAGCAAGGTGATCGCTGAAGGCG
GTGAGTGCCACGCAAACATGGTACGTCGGCTGCCAACGCACTTGGTTACTGTCTTCCACGGTCTGAAGCTCTCGCTGACGACGCTCGAGCGCCGTGCGAG
CCGCGAGCAACACGTGCGGTGCACTACACTCGAAAAACTCGGGTCGGGTCTCCAGTACCAGCGTCGTCACCTGCGCCGCAGTTCCCAGTAGCTTCACTGC
ATCCGCCGCATCCGAGTTCGAAGCTTGCGTCCACCACGTGCCGACCAGCAGAATGCTTTCGTTCAGTTCCTTGTTGCCCACACGACGCACCAGAGTGCCC
AAAGCTGCCCGAGCAAGGTCACGACATTCCGAAGCTTCGTCGTTGGCCAAACGGAGTACAagcggcaagaagaaaaactGCGAGCGAGCGTTCACCAGGT
CCTGCGGGAGCTTCGAGAGCAGTGAACGAAGAGCCTCAAGCACGGCAGAGCGCCCTGTGGCATGTCCGTAGCTCAAGTTGTCGACCAGGAACTTGAGGTG
ACGGGACAGTCGCTTGTTTCCAAGAGGATACTCGAGCAGGAAGATCTGGTAGATTGTTGCGCAGTTCAGACGCGCGCCAGGGGCATCGCTctgaaccagc
agctccccAACACGCAGCATCACATCGTACACTTCACTCACAACGAGGCGGGAGTTCACGATGGCCTTCAGCAAAGCGAAGGTGGCATTCTGGTGGTCTT
GCTCGTCCAGGTCAGCACGCAAGAAGCTCAGGAGCACACGCAGTTGCGGTTCCGTGAGTCGGAGAGTCTCGCTCTTGGAGTCCTTGGAGGCGTTGCCGTT
CTCCTGTGCAAGCTCCAACCCTTGCTGTTGTCTGAGAAGTGCAGTAAGCGTGCGGTAGCACGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCTGCCTGT
TGCAGGATCTTGAAGAGTCGATCAAGAAGTGGTGTGCGTGCCACCCGCAGAGCTGGGAGTTCTTCCTGTCGAGGAAGCAGCGAGCCGATGCACTTCAGCG
CGTTAATGACAGCGCGGTCGTTCTTCGACTCGCCAGCGCAGCGCATCAGCAACGGCACCAGCGGATCGACAAGTTGAGCCGGAGCAGTggagttcttctt
gccctcgtCCTGCTGGTCCTTGGCGCTGCCGCTCTTGCGAAGGAACGAGAATACCAAAAACACAGCAAAGTTCAGCAGCTCTCGGAGATGCGTCGTGCTC
TCGGCTAGGAGAACGGCGATCTCGTCACGCCTCTGCTTCTTGGTTTTGCTTTGATGCTGTTGGCGCATCTTGTCGAAGCCGGtaacttgctgctgcatcg
cgaCGCGTACGGTATCTCGGGACTTCACTCGTgctgcaagcagcttcgtggCTGCCGCACTCTTCTCTGACACAAGCCATGAGGTCACTAGAGCGGTGCT
GCTACCACCCGCTTCGTACTGCTCCTTTTCTCTCTCAGTGGTCGGGCGCAGACTCTCAAGACTCGAGTTGAGAACGTTGTATGCGTACAGGAACATGTAG
GACGACTCCACAGACGGATTCTTTGCAAGTCCAATTGCCACCCGCTTGAATGCCTCCTGGAGCGCAGCAGTAGCTTGAGCACCAGCGTCCGTGGCTTGGA
ACCGCTTCACAAGTGCACTCACTACTTCGTGAATGCTCGGGTTGGGCAGGAAGGGTAATGATCTTGCCAGCAACTCCAGTGAGTCCAGACTCCGTCCACC
GCTCGCGCGTGCCTCTTTCATCTTGGACTTGTGGGCCGACTTACGTTCCACACCTCCAGCGGCCGCCTCCGCAGCCTCGCCGATAGTCGTCATGCCCTGG
AACAGCTCTGCAGCCAGGATTTCCATCAGGCTCGGTACACAAGCATCCAGTGGAGAGGCAAATTCAGCCTCGCGCTCAGCCTCTTGTTCCTTGTTCTGTg
tgagcagcaacgactgGGGCTTGCGAGGTGGCCCAGCCCGTCCATCCACCTGCATGATCTCCGGCAGCTTTTCCAACAGCGCATGCACGGTGAAGGACAG
CACATGGACCATGTATCCATCGCGCAGCGTGTGGCGAAGTTCCTCCACAATTGGAAGCAGAAAGCTCGCACCAAGCTCCACAGCGATTCGAACGAGCGTA
GTACGAGCCGAAACACGCACGGCCTCATCCTTACTCTTCAGCAAGTTCGCGAACTTTAGCAGCAACTTTGGCAATTCACGCTGGAACGTTTCAGCGCGCA
GTCGACGCAGCACCTTAACGACCGCCAGAGCCAAAGGCACACGCACTGATACTGCTTCCTCAGAGATCGAGGTTGACTCGGTGTCGTTGTCCTTCGCCTT
agagctcttcttcgaggtCACGCCCTTGAACAAATACGAGTAGAGCATCGGAAGTACCTGCGACTCCATGTTGTCCTCGACCTTGGAAGAAccctcttca
tcatcatttgcatcctcctcgtcgccatcggcCGGTTTGCTATCCTTTCGTTCCTTGCTGACGGACGTGGACGCCGATGTTGGCCATTGGGTCGCCGCAC
CTGGCGCCTCGAAGTGGAAGTGGTCAATCACAGCGCAAATTGACATAATGATAGCGCCTTCCATTTCAACGTGTCCATCGATCGACTTCAGCAGTCTGCG
CAGCAAAGAGAGGTAGTGCGACCAGCCCAGAAGCCCTGCAGCGCTTCCCACACAAGCAGCGGCCTCAGCACGCAGAGACTCCTGGCTCTTCGCGTGTGTT
TCGTAGACGAAGTGCAGCACCAGTGGTAAGATGACACCGTTTACCGTCGAGTTCGAAAACCACAGTGCCTCCTCACTCTCTTCGCCCTCAACTTGACCCT
TAGCCTTGGCAGCCATGGAATCCATGAGAGCGCTGAGGCGCTGAAGTGCACGGCGTCTGCGGTGAGCCTGGATGTGCGTAATGTTGTAGAAAAAGTCGGC
TTCAGGGTCCTCCTGGTTGCGTGCCAGTACCAAGTCCGCTGGAACAAACGCAAACTGCTTGAACGCCTTGTGTTGGTCCGCCAGCGATCCCAGCAACGTC
ACGAAGCCACGTCGCGCATTCTCATCCGTCGAGCGCAGACTTGCGCGCACGCAAGGCATCACAAGCGACTCCAGCGCATTAAGCACGGGAGACTTCGCCG
CATCTGCACGCTCCGTTTGCCCCACTGCAACCTCTGCGGCTAGTCCCAGGAATGTTGTAAGTCCGGCAAGTGCACCACTACGCACCGAAAACTCAGCGTC
ATGCATACACTGGAGGCATTGTGCAACAAGCGGGGCTAACAAATGGGTCTCGCGCGTAAATCCGGCAAAACGCGTCGAGTTCAAACGGTTAAGCGCAATG
AGACGACGCTCATAGTCCGTCTCCTCAATTTGCTTGTTGTCATAAGCGTTGAGCTCAACAAGCAATTCCGCCACGGGAGCCAGCTCTTTAAGCGCAGGAT
GTGCACCTAGGGCTGTAAACACCAGCACAAGTTTCAGACGTGGGTCACGATCAGCGATGCAGTTCGGACCCGGGGCTAACAGCCGCGCAAGGGCGAGCAC
ATGCTTCTTAGGCTCCGAGAGCTTGGGGACCAAGTGCGCTAACACCTCCAACAGGTTCTCTTTGTCCTTGGGCGATGTCTGATGGTTGCGCAGCAAAaac
ggcaacagcaactgGAACAAGTCGTGTGCAGCAATCGCTACGTCTCCCTCGGAGGCATCCAAGTGGTGTGACAAACGACAAAGGAACGTGAGCTCCTTGC
GTGATGACCCTGCATACCGATCGCTTGCGTAGCGTGCGGCCTTGGCTTGGAAACGCTGCACAAACTGCTCCAACACAAAAGGAATCTGGGGTACCAGCAG
AATCTTCTCATCTATCTTGGGGGCAGTCATAGACTCGTCTTGGCCGTGCTCAGCTAGCAAACATTCGTCTCCATCAAGCAGCGAGTCCATAAACTGCAGA
ATTGAGTCCAAGATCTCAGGTGAAATACCACGAGTTAATGCAGACGATGCGCTCGCTGACGTCAAGCCGGCAGCCAAGCAGGAGATAACGTTGAGTATCA
GAGGCTCCGGGACCCACTGACGTGCTCTGTCCGCGTGACCCAACGCCACAAGCAATTCCAAAAGCGCTGATGCTTTGCCAGCGCCGACAACAGCATTAGG
CATATGCTTGATTGCTTTGCGTGATGTCTCCAGCACCGCAGCTACCCACGGTTGGAGGTGCACGAGGGTGTCAAACTGCAAAGCATGaaacacaacaaca
attAGTGTTTGAATCGACATAGATCAATGAATgcgacgagaacgagttTCGTACCGTATCGATCAACTCCGCGAGCCGACGGTAAGTTAACATGcggatc
tgcttcttcatcgatgcAGAAGTCGCCAGCATATCCGCAGTCGATGACGTGTCACCAGCTTTGCGCTTGGAGCCGACCGCGACTACTGCGTTCTCTTCGT
CTGCCTTTTCATCGTTctcgtcgacttcagcagaaccatcgtcatcttcgcttGAAACAACGCTGAGCTGAAGgatcgccagcagcacatcagCAATACG
AGGTACGAAAGCCGCCAACTTCACACCGAGTTGGTCGATAAGGTCCTCCAGCAGATTCAAGAAACCCAAGATACGCGAAGGTTGCACGGTGGCAACTGCT
GCCACAGGCTTCACCTCATCAGCGGCGACaagagctcctgcagcaacactcTCCGGAGCTTCAATCGTCACATCAAATGCCCTCACTACCAATTCCACAA
AGCTTGCTAGCTCAGGTGCTTCCAACGCTGCTAAGTACGCCAGGAtggcagcacgacgagcagccACGGTGTCACCGTTGTTACGACCCTTCTTGCTAAC
ACACTTTGAGTACAgaacgcgcagcagcacaggcagCAACTCCAGGCGGTGTTCATGTAGCACTacaccttctccatctccaacCTTAAAGCTGGCGAGT
TCTTCGCGGAACGAAGATGAGTCCGTCAGTCGGTTCAGCTGCGTTTTGTAGGACACGATAGCCTTGCTTCCGAACGCGTAGATGCACTGCAAGGCTAGCT
TCGAGACCACTTCGTCCGACTTCATCAGCAGGTCGAAGAAAAGAgcgtgcagcaactgctgtGCATACGCACCCTTCATATTGTGGAATGCAGCGAAAAG
CTTCAGCTGATCCACAAATTTGCCCCGCACTTCCTTAGTAGTCAGGCCCTGGAACTCAACTAATTTTCGCCAGTCAGAAGATGCCGAGTCACTGGTGCCG
TTGGCTTCTTCGAGCTTAGCAAGCGCCTGGTCGATTTCCTCCAGACGCTTCGCGTCTAGCTCATCCGTGTAAATGACGCTGTATTGATCGCGCAAAAATG
TGAGGAAGAGCGGCACCATAAATTTCGTCTTGGCTTCTACGAGGTCGGTGAACTTCATGAGTCCCTTCCAAAGCAGCGAATGGTGAGTGGCAGCATCTGT
AACACTTGATGCAGGCACCTTACCCTGCTCCAGCATGCACACACGCTTGAAATCCTCGACAACAGCGCTCTGGTTGCTCGGCTCGCTAATATGTTTGTCA
TTCGCGTCGTCGTGGCGGAGTGAAGCCACCAGAAGCTCCGCGCTGACGCATGGCCAAAGCTCGTTAAAGTGCAACCGCACCACAGTTTCAACTGCGTCGG
CGATATGCGACCAGATAGTGGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTCTTGTACAGCTCAGGGGTCTGTGGAGAACGGCA
AAGGATCTTCACTCGTGTCAGCAGGCGCACGACCTCGCGTTCAGTGGCCACAGAAATGTCCTTGCATGAGAGCTCGAGGTTTACGCAGATATCCGGGAGA
TCGCATGGACCGCTTAGTGAGCCGCTGTCAGAATCAAGAAAATCCGAGCGCTTGAACTTGGccaacagctgcagcgccaccaagcGCAGTTCATGCGCGG
GTGATCGCAGTGTTGCAAGAAGAGAGTTTGCTACACGGGGTAGCGCATCGACTGTCAGCACTGCGTGTTGTTTCTCCTCTGGTTCCATTTCAACCAGCAT
CAACAATGTCGACAACGTCTTGAACGAGGACCTCTTTCCGAGCAATGCctgctccaccttctccgtcgtcatcgccgaATCCTTGCCCTTGCTTTGGTGC
TTAGcaatttgctgcagctgccacaACTCAGCACGCAGAGAGGTAAGTTTGGTAGCCGACGTGGCAGGTTCGTCCTTTAATCGGTCATCGCACATCGTGA
TAAGGGGTGAAGTGAAGCTAATCAGTTTAGCATCATTCAATTGCAGAAGCCCCAACGCCTTGCAGAACTTCCAGCTCACAGCCAAACTCTCACTGTCCTT
TAGCCTTTCGTTctgcttgaagagcttctggCCAGCGTCAAACAGTGTCTTCTCGGCGTTGGTATCAATGTCCTCAAACGAAAGCAGCCAGTATCGACTG
TTGCTCTTCGAGCGCACGATATTTGCGCTCTGGCCCTCATTGATGTCACCTGCGTTGTCTGCCACGTAGTCGCCAAGTTGACACAACAACGCGCTGAATG
CACCCACGTCAGTCTTCACAAATTTCTTCAGCGCGAATTCCATAGCGTTGGGGAGCAAGAACTCGATCACGAACCCCACGTCGACGTGGCTGTTGTGCAC
CGCCTGGTCTACGAATTCCAGAAGCTTCTGACGCCAATACACCTGCTTTTCCTCCTTCGCTGCCACAGCAAAAATGGCCTTCACCTGGGCTGAAACtacg
tcgtcttcagcggGGAACAGCCTCCAAACCGCTTCAAACGTCTGCATCAGTACATCTCGCAGTACTGTACTCTGAGAgaccagcaccttgttgtcAGGAG
AAACCAGCGCAGTGCAAACTTTGTGTACGCTGGGCACTCGCACCTCATAGGCATCCTTCGCCTCTGTGATCAGTTTGCCCATCCGAGATATCAAAAACCc
gagcagcacacgcagcacgCGACTCAAGTACAGATCGTCCGCCTCTGTCGGaatctcctccttctcgtgcCGAATGGTCGCCACCTtgttcaccaccagc
acgagaCAGTCCAGCATTTCGCCCGAGTGGTCCGCGTCCGTGTGCTTCATCATTTGTCCGCACGTCTGGTGCACAATATCAAAaactgcttcttgctgtt
caaTCTGCTCCTGCGTCCGTTCCGTCTCTAAATTCTTCGGTCGGAACGAAcccagcaggaacagcagcacctcgcaCATCCGCGAGTGGAATCCGTGGCT
CACGTTCTTCACCAATGCGAAGAACAATTTGGCCGATCCGTCTCTTAGAACCTCATTGCTGCGTCCCGAGCCTTTTACCAGTGCCGTCAAGTACGCACGC
AGGTACTTGCGCATGGCCTTGGGCGACTCCAATCGTCTCAGCAACACCGCCAACGTCTGTGCTGCGAAATTCCGTACGAACTCTCTCGGGTGGCCGAGCA
ACGGGAAGTAGCACTTGTGCACAGCGTCCATgtccgccagcagctgcacgcgcaaGTAGCTGAAGAGCATTGTGAGCGTCTTGAACACTTGGGTGCTGAG
CTCCGGGTCTTTGGTGTCAATCACGGCCACCACGAGAGGCAGGAGGCCGGCGAAGTGCGGGTAAAACTCCTTGCCGAGCTCTCGAGCCAGTGCTGtgacc
agcttcagcacggGCACGAggcgctgccgctgcaccACGAGGTCTGTGCTGTCCtgcgcgtcctgcagctccttctgcaggCGAAGCACGACCTTCTTCA
GATGGTGCAGCAGTTGTGGAGTGGTGGTCACTagcggctgcagcgcgcggAAAAGCAGTTGGAAAGAGTCGAGCGTCGTGAGCTCCGCCTGCAAccccag
ctcctccttgaaCGACAGCTGCGAGGACTCGTCCACGGCGCCCATCGTCTTCGCGTGCAGCGAGAGCTCATGCTGCAGGTTGCTTACGCGCTCCTCGACC
TTCTGGAAGCGGTGGCGCCGCTTC