Description :
From Genome Similarity Track
Location :
Scaffold_16:39741- 43444
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_16-abinit-gene-0.75Ser/thr kinase

Sequence
3703 bases(100 bases per row)
ACGGCAGCAGCAACGAGGATCGCTTGCAATAGTTGCGACGCAATTTCCTTCACCAGAATCATATTGTTCTCGTCTTGCGCCAGCGCATAAATGATCGGGT
GAAGGTTGTACTCCACGAGGAACTGAGTGGGCGACGTATGCGATTCGAAGAGGCTCTTGAGCATTTTCAGCAGATTTTTCCGCACGATCGCTTTCGGCAC
GAGCTGCAAGCGCTTCAGGATCTCTGTCACAAACATGGCACTTCGCCCCAGCGACTGATTTAAACGAACCGATCGATTCGTCATCTCAATCAGCGGCTCC
AAGAGGTTTTCAAGCTCTGTATCTTGAGCCGAACGGAAGCACATCATGAGTTTCATCAGATTCTTTGGGATCAGCAGGACGTCCTCCACTTTCACCGTGT
CATGAACCAGCCAGATACTGATCGATTTGATGGCGTCCATTTGCCAGTACTTATCGTCCAGCATCTCCAAGAAGAGCGAGACTCCATCGCAAGCCCACAA
GTGTGCGCGGGCAGTGGGCGACGCATGGGCCAAATCACATAGAATGGGGAGCGCGAACTGCTTCAAAGGGCTGGCATTCTTGATCACCTTCATCAGCGAC
GGGATCACTCCAGCCTGGGCGGCATGCGTTTGGCGGTTGCGATTGATTCGGCAGAGGTAAAACATCGATTGGAGCACGATATTTTCAACCTCCTTTCGCT
TGGACCCGTGGGACGTCTTGGTTGAAATCTCTGCTTCCTGCTCGTTCAAAAGATGGACCAGCGTAGGAATCGTGCCTGCACGATCTAACTTTTCCAGAGT
GATTGGCTCCATGCTCAGGTTTCGAATGCACTTGAGGACTTTCACCATCGCAGAGACAAACTCGCCTGACTGACGCACTTTTTGAATCGATGATTGATGC
GCTGGACTCTCTTTTGCACTCGGCAATACTCGTCGGTGCAGTGCCTGCAGCAGCCCTTCGAGCACTGATCCGTCACAAACATGCTCCTTCACAACCGCAT
CGCCCTGCGAGAACAGCATGAAGATGTCACACGTTTTGTGCAACTCGTCCATCGTCCACTTCTTTGGTCTTCTCTGGATTGATTGGCTGCGATCTGCTGT
TGTGTCTGTGTTCCTGCTGGCAAAGTCGTTATCCACTTCTTCAATGGCATCAGGAGCGCAAACCGACTTCACAATCTCGTTGAACACCACGATAAACTTT
TTCAGCAGTCCGGCCTTCACAAACAGCCGGCAAATGTCGTTCTTCGGGATCGTCTGAAGGTTAAACACACTGAAAATCCCCTCGAGCGCGATTCTCAGCA
AATCAATTTCGCTGTTTGTTGTTGGAATATCATTATCGAGCGTCAAGAAATCCACGAGCACTGGCAGTCCGCCACAGGCAATAAACATCTGCAGCGTCAA
TGAGCTTGTTTTGCAGCTTTGACGGACAAATTTGGCTGCTTCCAAGCGCACAAACGCCGCGAAATTCTGTGCGCTCGTCGAATCCATGGACAGATGCTCT
TCCGAGAAAAGGGCAGAGGAATAATCCTGCTTTGTAAGTTTGATAATCACTGGAACGAGCCCGACGAGCGCCAGGTTTTCCTGGAACTTTTGATTATCTT
CCACAATCTACGTCAGAAAACAAGAAGCACAAGGTTAGCAATCACCCGACCATTTTCTGTTTCTAGCCTCTCCTACGTACCATGTTAATAACCTTGAGCA
CAGCATAGAGGACATCCATTTTCTTCATCTCGAGTGCTTCCATTATATTGGGCACCACACCAGGTTGCGACATGAGATCCCTGCGAAGTGCTTGGTTGGA
CTCGAAAATCTCTTGCTGCACAGACATATCGGCAGGTTCATTGAGATAAGTAAAACGATACTCGAGAAAAGAGAGCCAAGGAAGACTATAACGGGACTCA
CCAAACTCGTGCACGCATCTAAGATCACTTGGTCGTCCATGCTTGGATCCAAAAGTGCCAACAACTCAACGACGCGCGACGTCGCTTTCTGGTTGTTGTC
TCGAATAGAAGAGTACTCGAAATCCATTTCGTCGTCAAATAAATAATCTGGCAGACTCTCGGATGCGTCTCTGGCACTGAGCATATCTCGCTTCGACAAT
CGATGCGGGAAATCTTGAGGAAAAGTCGAGTCAACCATGTCATCAAAGCCCGAATCGTCGTCGTCGTCATCGTTGAATCTATTGAGATTGGCTGAGGTCG
TTTTCCCTTCGACGGATTTGTCAGCGGTTGACATAGTCTTCTTTCGAGCCACTGCCTGAATCAGTTGCTCTTCATCAAAATCCTCAAAACCGAGATCGCC
TTCCTCGGTCTTTTCTGAAAAACTCTGTAACTTGGTCAAGCGTTTTTCCTTCGGCACAAGTGACGAGCGGTCCCATGACGTTGTTGAACCAGGGATGTCT
GCACCTGGTACTATCTCGCTCTTAATTGGATTCGCTTTCTGGATAGTACTACCTGACCGCGGCGGTTTTAATGCATTCCGTGCGCACAATTTCTCGTCCT
CTGCGGTGTTGTCGTCGTCATCTTCCCACAGTTCGTCGTCAAACAACGCGTTTTCATCTTCTTTGCTAAGCTGGAACACTTTTTTCAGCGCCGACACAGG
CTCATCCGTTTTATTTTTCGATCGCTCCTGGTTTCCTGCAGGGACCAACGACATGGGCTTTGGAGTCGACTCAACACCAAATTCATCGTCCCAGTTCTCA
GCATCGTCTTCTTCTTCTTTAACCAATTCATTCTGGTCCCCAGGACTCGCTTCAACAAAGGACGACGACGTGTGCTTTTCCTTTTCGTACTTCTTGATCG
TGTTGAGTACTGCGTCGCGATCATTCAGCGAGGATACGTGTTCGGACACCATCTGCGAGCTTTGCTCCACCTTGTTCTTCGGGATCTGCGCAATCCATGG
ATGCGTTAGCAGTTCTTCCGCCGACCCACGCAGACGTGGCTCCTTCATAAAACATTTCATGATAAAATCGTGCAACGCCTACACACACATACCACCACAA
CAGCGTCAACTAAACTCTAGAGTACGTCAGCACGTAAGAGAACCACTACACTAGGCACTTTACCGGTGAGATCCGCTCGGGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCGACAAGAGTTCAATGATCGTGCAC
CCGACGCTCCAGATGTCCGACGCAAAGGACCAGCCCGCCATCTCAATCACTTCTGGCGCCACTGTCAATACCAAAACATGGGCACACGTGAGTCCGTTGT
TGCGTCTGCGACTGGGAAAGTATATAATCAACACTCACTCCAGTAGGGCGAGCCGACAACGGAGTTGGACTTTTGGGTCTCGCTGAGCTTGATCGCGACG
CCGAAGTCCGCGAGTTTCACGAGTCCGTCCTTCGTCGTCAGGATGTTGGCGCCCTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGTTCGTGGAGG
TATGCCAGTCCGCGCAGCACCTGCGTGATGTACATCGCGACGAGCGTCTCGGAAAATGATCCGAACTTCTTCATAAACTGCGCAAGCGAGCCGTTCTCCA
TGTACTCGAGCACGATGTACAAGTACGTCTGCGTGCGGATCGTGTCGTGGTACTTGACGATGTTCTCGTGGTTGAGTTTCTTGAGCAGACTGATCTCGCT
CTA