Description :
From Genome Similarity Track
Location :
Scaffold_32:397393- 402400
Transcript NameFunction/comments
Phyin_T30-4PITG_14060Glycoside hydrolase%2C putative

Sequence
5007 bases(100 bases per row)
GATAACATGAATAACCTCGTGAACTTTGACGGCCTTCGTTTTTCAAGCTTCCGAACCATGTCAGCAAGGTCGACGACATAATTCTGCGGGTCCTTCTAAC
TCCCGTTCTCGTTGATTATGAGCAATCCCAGGGATGCACTCAAAACGATACGCCTCTGTCTCCTCCGCGATTTTCATCCGCCGCTTCTTTGAAAGAAAAT
AAAATAAAATTTCAATTGGCGATTCAGCATACACAGCTGCTGATCGAGTCGGCCCACATGAACCACCGTACAATTCAGCTACATCCAGCTTCACATCACC
TACAGTGAGTACGGTACAGAGTTAGACTGTACATTATTAGTAAATTCTGTTTAAAACAGACTTTACGCCATGGGCTTCATCGTAGATATCCCAGCGTGAA
TTACCCAATACGCGCATCTCATCGTCGTCCTGCTCGAAAAGAACGCTCTCATCTTTAAATTGGGGATCTGATTCAATGTCACTCTCGTAATCACCGAAGT
CATTTCCTTGTTCCTCAAATGCACTTTCGTCATCTTCGAGGTTATACTCGTCCAAAATTGGCTATTGATATTGTCCGACGCGGTAGGTTCAAATAGGGCC
TCTGACCGGAAAGCGGCTAAGAATTCTTCGCCGTCAAAGTCATCCAATGTGTCAGACCTTTCATCAGGCTTGGTATACACCTCGGATTTTGCAGTGTCGG
AGTATTCTTTATCATCCGGAATATAGACTTAATCGCTAACGACGTGTTCTGTATAGTCGGGAACCGGCTTATCTTGAGCGGACGGTAGCGCTCCATCCTG
CACCTCAGACGTCTTTTCGCGAGAGGAAGAGGTCGAAGACAGCACCAAGCCCAGCGAGGGAGCTGGTACTTGCCTACGTAAGCCACTTGCTTCCCCATCG
GCGGCCTCTGAACAGAGCTCAGTCTCGGGATGCCAACTTCCACTGGAAGATGAAACAGACCGGCTTGGCGCGCATACTTCATCAGACTCTCCTCGCCTGT
AATGCAATATTCTGTTAGCAAAAGGTAATGTATCTGTTCATCAATACTGTAAAGCATACCGACAAAATAGCCGACGCCATTCTTGTCTGCGCGTAGTCCG
CAAGACACGCCTGGTTTGACGTAAGAGTGGTGGCTGCTATGACCCGAGGGATTTCTCGGCTTCCATCTTTCCTTGACCAACTCGCGCCACAGCGCCTTGA
AGGGTCTTTCGCCGGGTCCGTTCATCTCGTCTTGCAGAAACTAAAAAATGAGTGGCAACGAGGGGGAAGTGGTGCCATTGATTTAGAATTTCAAGCCTCT
GGGTCATTTATATTGTATTTTCTATGGCGGTCGAATAATGCCCGTCAATCTTCCCTTCTCTTCTTAATCCAAAGCGATAAGTTGACCAAACCCCACTTTT
ACAAATACATATACGGAGGACTGGACTCCTTCTGTTATAACGATATCTCTGTAAAATGCAGAATATCGTCTTAGAAGGGTAAAGAGACCTAGCAATTTGC
AAGGTTTCACCTCCTGATGGCAATGTTGCCTGTTGAAACCATCTCATCTCAACATAGTCTTAGTTGTTTGTGGTGCTAGACGCCAGCCGCTAGCTCACGC
TTGCATAGAACCGTAGTCGGCAAGGTTTCACCCTGATGTGGAGAACAACCTTCCTAAAGCGAGTCGCTCAATGTTGCCTGTTGACACCATATCATCTCAA
CATAGTCTTAGTTGTTTGTGGTGCTAGACGCCAGCCGCTAGCTCACGCTTGCATAGAACCATAGTCGGCTACGTCGTAGCCGCGCCTCTATCTAACTAGA
ATATCCTAGAAAAAGCACGACCCCAACGCTCTCTCCGCAAAATTGGCGGTGTAGTTGTTCGTGGCGTTAGCGCTGCCGCTACCGAAGAGCATGGGCGTGC
ACGAGCGTACAGGGGGCGCGAACTTGGTGATGCATGCGGGTGTGGTGGTCGTCTAGGCGCGCTGCGGATTTCGACTCGCTGAGCTTATGAGGAAAATGGG
GATTCAAAGCTGGTAACAGGCAAAATCAGCCAACCATACTGTAATAGTAGCAGATTTTTCATGTTATATGCCAATATTCCTTGATGTTTTACTCTGCCCC
CGATTAGAAATAAATGATACTGGTTATTTATAATGGCCCGGGTGGTCAAACTGGCGCGTTACCTTACAATGAATTAAGTTTACGCGCAACCGGTGGGATG
CCCCACAACAGATCGGACCACTTCTAAATTTTTCTGTCTGCTCCTCGGCCCACACTAAAAATGCTTACTAAAATCGTCACTGTCGCCGCTGGACTTGCCG
CAGCGACGGTATTTGCCGACCAAGAGCTCTGTGGCGAGTGGAACTCCACGGAGACCGATGAATATATTCTGTACAGCAACCTGTGGGGAGCATTCGACGA
CCCCAATAGTAGTCAGTGCACGGGTCTCGATAGAGTCGTTGATTCGACTATTATTTGGCATATGAGCTACAGCTGGGCCGGGACCCCGTACCAAGTAAAG
TCGTTCGCTAACGCGGCACTCAAGTTCCACCCAGTGCAGCTTTTACGCGTCAAGTCGGTTCCCGCGACCATCGAGTACGAGTTTCAGCACAGCGAAAACA
CCATCGCTAACGTCGCGTTCGACCTTTTTACCAAGGCGGCCATCGATGGAGAGGTCGAGAACGAAGTCATGGTGTGGACGGCAGCCCTGGGTGGTGCTTT
ACCTCTGTCGACGTCGGGCAAACCGATCAAGACGGCAACCATTGGCAATTTCGACTTCACCCTGTATCAAGGCATGAACGGGAACATGACCGTATTCTCG
TATGTTCCCGACAAGATGATAACAAGTTTTTCGGCCGACCTCAAGAAGTTCTATGACGGGCTTCCGAAGAAGTACAGGATCAACCCGGCTCACTATCTGA
CGCACGTGCAGGGTGGCGCAGAGATTCTCATCGGAAATGGCACGTTGACTGTATCCAAATATCAAGCGGCAATCCACACGACTAAAAGGCAATGAATCCA
GTACAACTAGCTAACTAACGATTGTAGGCAATTTTACTGCTAAAGTTGGATGGTAATGGTCAAACTCTTCGATACCACAGGAATTTCGCTGGCTTGAGTG
ATTCATTCGAAGATGGGATTCTTAAATAAATTCTCGACAGTTGTTGTTTCCATTGTTGTTCCGCGACCGATCTCTTGATGGCGCAAGCCTTTCCAAGCCC
TATCCTTGTTTGAAGTCTGTAAAATATAACTGCATACTTAAGTATATAGTAAAATACATGCACATTCTATTTATACTGATTACCATGTTCGACGCTGATT
ACTCATATGGGAATCAAACATTAACTTTCACTTGGAAACGGGCAAAGTCCCAGTCAGAGCCCGAAACGCCCTCTATCGGAGATCACTGGTGACTCTTGCA
TCATTCCTCAACTTGCCTAGATGAAACTCTCTGCTGCCCTCACCACCATTGCAATCGCCACCGCTTCCGCCGAGACGGAATTCTGCGGCGAGAAAAACAA
GACAGAGACCGCCGACTACGTCCTATACTACAATCTATGGGGCGCTTTTGACGATCCCAACGGCCACCAGTGCACGGGCCTTGATAGTGTCGACGGCTCA
ACTATCTCTTGGCACACGAGTTTTAGCTGGAACGGAACTGCGTGGCAGGTCAAGTCGTTTGCTAACGCGGCTCTGAAGCTCGACCACGTTCCAATCGCAA
ACGTCACATCGATTTCCTCGACTATCGAGTTCCTCTTTGACTAAGAAGAAAAAATTGGTTGCCAACGTCGCCTTTGACATGTTCACGACATCAAGTCTTG
GTGGAAACGCAGAGTATGAGGTCATGGTATGGCTTCAGGCCATCGGTGGGGCTGGTCCCCTTTCAAACACTGGTAGACCGGTCAAGGAGGTGAACGTGGG
TGGCGTGGATTTCAGTTTGTATCACGGCAAGAACGGTAACATGACGGTATTCTCCTATGTCGCCGCTAATACCACGAATAGTTTCTCGACTGACTTCAAG
CAGTTTTTCGACGAGCTTCCATCCAACAACACGATTGCGCCCGAACAGTACTTGATCAACGTTCAGGCCGGCACCGAGCCTTTCGTCGGAAACGGAACGC
TGACTGTATCGAGGTACTCAGCTGCGGTTAACACTGCCTCGACGTAACCTTACAGGCGGTACTCCATTAAAACAGATTACTGGACCTGTGTAGCGTTTGA
CAGAACGAGAGGTTTACTATAGTATTGGCAACATAATTTGACGCCCACGTACAGTTACATGTAGCCCGATAAAAAGAGTAAAAAGGGTACCGCTTGCTTC
AATTTCATTTTTTGCTCTTTAGTTTCAATTTTTAATTTGATGTGGCCCTATATTTCATGTAACGGGTTCTTCCAAATAATATACGGTATACCATTCCATT
AGTATACCCAAAAATTGCATACTTTTGGAGTGGAATTAAAAATTTGAGGCGGCACCAGTTAGCAGACTGTGGTCGGTTGTTTTTCAATATACCGAAAGAC
TTTCTTCGCTTCGACTCTGGGACGTCCCAGCGCTGAACAAATAAGTTTTGTGCTGTGGATTTATGATATTGAATTGCTCTATATAATCGTCCAGAGCTTC
TAGCTTCCCACTTGACGCAAACCAATGAACATTAACTTCACCTATCTTCAGTAACGTGAAAACATCTTTGACGGTCTTATTGTTCTTTAGCCAATCGTGT
AGCTGATTAGCCTGTAGCTTCGTTGCAATACACGTGAACCTGGTGGCCTCCTTCGCGTTCACGAGACATTTGACAACAGCACCCTCGCCATACTTTGTCG
TGAGCACCCCAACCACTGACACTTTCTTCTCTGGGTACTTTGTGCTGGACATTTCCACGTAGCTGATCAATACCTGCAGCTTTAGACTGGCAAGAGCCGC
ATCCACGCCTCTATTCAGCTTTAAGTTCGCGACTACGTCAGCAGGTGTACTTTCATGGCCAACCAACATTCAACTTCGTTCCTTCGGTAGCTCGAGAGAA
TTTCGAT