Description :
From Genome Similarity Track
Location :
Scaffold_53:39738- 42921
Transcript NameFunction/comments
Albla_Nc140473604aminobutyrate aminotransferase putative
Albla_Nc14047370conserved hypothetical protein
Albla_Nc14047380NimArelated protein kinase 6 putative

Sequence
3183 bases(100 bases per row)
TCCAGCATTTGACTGGCCAGTGGCGCCATTTCCAAAGCTCAAGTATCCTCTCGAGGAACACGAAGAATACAATACAGCAGATGAAGCACGATGTATTGAA
GAAGTGGAGCGCATTTTACACAAATGTAATCGGCAATCCTCAAGAGATGTTGAGCTTACTATTGCTGGGATGATAGTCGAACCGATTCAAGCAGAAGGTG
GAGATAAACATGCAAGCAGAAATTTCTTCCAAGCTCTCCGTGCTTTGTCTACGAAGTATGGGATCGCCTTTATTGTAGACGAAGTACAAACCGGTGGTGG
TGCGACTGGTAAATTTTGGGCTCATGAAGACTGGCAATTACTCGATCCTCCAGATATTGTCACCTTTAGTAAGAAGCTGCAAACGGGAGGTTATTACTGC
AAACCAGAATTCCGTCCGAAAGAAGGTTATCGAATTTTCAATACGTGGATGGGTGACCCAGCAAAGCTACTCATGCTCGAAGGGTTCTTGCATGCACTAG
ATCAGGATGATTTGATTGAAAACACGAACAGTACAGGTGTGCATCTCATGAAAGGTTTCCGACAATTGGCACAAGCATATCCGAATATTTTGACGAACGT
AAGAGGTCGGGGCACATTTCTAGCCATGAATCTTCCATCAGAATCTTCCAGAAACACATTTCTCGAGAATCTCCGATATCTTGGAATCGCATGCGGCGGA
TGTGGCAAAGCGTCAATTCGACTGCGACCGGCGTTGATCTTTGGCACACTTCACGCCGATGAATGTCTGGAAAAATTTGAAGCCGCTTGCAAGAAGTCAC
TCCCCAATAGCTGTAAAATGCGATGAGATCGTGAAGGGATAATTATTTTTCAATCGCGCTCTCTTTCTTGAGTTAAACATTGTTATACACGCGGTGACGC
AGATGAGCTGTCGATACATCTCGAGCACTGTAAAGACGTAGCATCGTAGGATGATCTGCCGAGGATGAAGCATTTATGTTTTCGTTGGATTTAATTGGGT
AACTACGGTACCATCGATGCTCATCATTTCCAATGATTTCTCCACGTACCAAAGTTTCCTCATCTGCCACACTTTTTGATGATTCAAAAGCTCTGAAGAT
GGATAAATCTGTTTCGAAATCTACTCCACCAAGAGCTCTTACGCAAAGGAAGCAAGAAAGCTTACGAAAAGCCTCAGGAAAGAAGAAACCATTCGAAAAA
GCTGTACCTCAACTTGGTAATAAAAGCTGTAGGAAGCGAAGAACATCTTTATCGGATCAAAAACCTGAAAAAAAAGTGAAAACGAAGCGAAATCCGCCAA
CATCAAAATCTTCGATCGTACCAGGAAAAGCAAATCCGCTATCAGCTCAGCGTTCAGAAAATGTTGCAAAAAGCTTCGTAGAGTTAGATGTAGTCGAAGT
ATACAAAACGATTCGGAAGCATACAGGAGCACTTGGCGGAAATGCTGCAGGAGGAGCAATTTATGGTGAGATAACACGTAATTCTTTCCAGCGTGTCGTC
GATTATTTGAAGCTAAATTGCAATTTTTCCGAAAGCTCACTATTTTTGGACGTTGGATCTGGTTTAGGAAAGCCAAACTTCCATGTCTCCATTGATCCTG
GTGTAGAAATATCTTTTGGAATCGAATTGGAAGAAATACGATGGCATCTGTCGCTTCACAATCTCAAAAGTGTATTGCTTTTAGAAAAAAATAGATCCAA
ACGAGCTTGTACGATGTTCTCCGTGGGAGATATTACGAATGCGGCAACGTTAAATCCTTTCTCGCATGTATATAGCTTTGATGTCGGCTTTCCACCAGAT
GTTATGGATAAGTATGCAACAATCTACAATCTGAGCGATGCTCCATTCTTGGTGAGTTTCCATGGGCCTCGCAAAATCATTGATTTGTACAAATTTGCAG
TCGAAAGTATGGGGCAGATTGTTACCGCAATGGCTGGATCTAGTGAAGTGCATACGTGCTACTTTTATAAAAGGCATTCGCAAGAAGTATGCACACGAGT
CAATACCCGACGAAGCTCCATCCATGCCGAAGAGCGCATAGACCCAGCAGACGAGGATCCTGACAAGATACCCAATACACTGCTTAGTGTTGATCCAATT
TTCCAATCAGGCTTTGAGATAATAAATCGTGGTCGTGATGGAGTTCTCGCATGGATCGAAAGCTTTTTCGGACAGCAGCTATGTACTGGACGTACACGTA
GGCAAAAAGCTTCAAGCGCACGACTAGCCAAAGAAGTCAAGTACGAGCAACGCCAATTGCAGTCGTATTATCGTGTGGTGGGGAACAAGAGGGCTTTTGA
CGATATTGCAGAAGGCTATGGCACCTATAATGTCAAAAAAGGATGAATTAATATCTCGAATCTTCAATGTTTATAAACGGTTTCCACTCAATCTTACTAG
AGCATTATTAAGCTTCAATTGAAGCATCTAGAACAGTATTCCGATTCAAGACGTTCGTTGTTGTGCTTTCCACAGATACGACCGCGCAATCTCCACTTTA
CGTTTGAGCAATCGATTCTCGTCACAAAGTTGTTCATATCGAGCATCAATATCAGCCACAATGGAAAAATCACTCAAGCTGTGGCATTTGAGCTGGAGAG
CAGCCAAAGCGTTTTCCAATCGCGCAGAAATTTCGATGCTATGTGTGCGCGAATTTGCTATTCGAGACTACAAAGAGTTGACAAAAACCGGCAACGGCTT
TACAGATTCAGCAGCTTACCTTGGTGGTATCGATCGAATTCCTGCCTCTATCTATCCGCTGCTTAGTTTGGCGAATTGCTTGAATGCGATCATGAAGGAC
ACGATTTATTTTCTCCTCTAGTGCCTCGATAGATTCCCTCTCCCGTTTCTGAAGCTATGCAGGCAGCTTCATCACTTCATCATATAGGTGCTCAAAACAA
CAACGATCCATGCCTGAGTGAGCGATGTCAACGTTTGCAGAGTCGGTAGCCTCAACTTGGTATCCACATCTCCATAACGCCGATGAATAACCAAGTGCAC
CCGCCACGAACAATCATATACGTTCTGGGTAGCTTTCAGTCTAGATCGGAGTGCTTCCAATTTGTGACTGACCCTCTCGACTTCATCTTCCCACACATCT
TTTGCAACTTTTGGGAAAATATAATCACGGTCGTCCAAATTATCTCTTCTATTGTCAGCTCGAGCATTCACCTCAGCAAGATC