Description :
From Genome Similarity Track
Location :
Scaffold_972:39716- 41845
Sequence
2129 bases(100 bases per row)
CGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTTGATTCCAGCACTTCAGTGGCTAACGAATCCGAGGCCGAGT
TGTATTCTCGTACAATGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGC
GATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATA
CCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAAC
TCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAACGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTC
CATTCGAACAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGGCCTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCA
AAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTAT
GCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACGTC
CTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCG
TAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATCTGAAACACCCGTCTTCAA
TTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGA
ATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGT
CAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGC
AAATGTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCACCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGT
ACCAGCGATGATTCGTCTGGCTCCCCGCTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGCTGTAGTACAGGGTCGGTCTTTTCCGGTTCTTCGCGGT
CTGCCGCGAACTTCGTTTGAAACGAATTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCA
ACCTCCTTTAGGTTAAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGATCTTTAACCCAAAGGGCATGCGTAACCACTCA
AAATGTCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATA
GGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCG
GATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGT
TGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAG
TGCGTTACCACTAGCAATCAGGATGTGTT