Description :
From Genome Similarity Track
Location :
Scaffold_53:39714- 40724
Sequence
1010 bases(100 bases per row)
GAGCGGAAGGCAGCTCGATAAAGGAGTCCGCGAGCAAAGCCTCCGCTTGAAACTCCAAAATCAGTCTCCATAGTGTCTGTCGTTCTGCTGCCGTAAAATA
TTCACGTTGTTTAAGCTTTTTGTTTGGCATTGCGTCCACGCCATCATCTCCACGCCTGCCCTCTGCTAATTCACCATCGTAGAGCGGACACTGACCCAGA
TGCTTTAGCCAATAGTCCTTGCGCCCACGTATGCGTTCCGGTGTAGGTCCAAGGCGCTCAGTGTACTCTGCAAGACACAGATTGCATACAGTCCAGTACA
GCGAAGAATTTGCCATTTCGTTCGTACGCGTAAAGTGCTCACTGAGGGAGCTTTGAGGGCGTCCTGCCTTTGGTTTCGGTCGCACAACGTGCATCTTGGT
CTGGTGATGAAACTACGAATGGTAGGCACTAGAGAGGGAGTGTGCGATTTCCCCCGAGGGACTCGAAGGTGGCAGATCAAACTTCAACTCACAATCTGTT
TTTTACAATTTTACGTAAACGCTCGTTAATATTGTAATAATTTACTTTAGAAATATATTTTTACTTAATAATGTAGAAACCTTTTTACCTAATTGATCAA
CACTGGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGATACCCTGCTTCTCCATTGATCATGTTACTGCG
ATAAAATCAGTTGGCATCAGCACTTTCCCAAATGTGCACTTCGTAGTTTGTCTGCGACATCGGCTGACCTTGAGTAACGTTTTCTTTTGATTGCTTGTTT
GCTTCTTGCCTGCCGTCCTGTCTATCGTCCATCTGATTGTCTCCCGTTGATATCACTGACGGTTCCACGACACGCTTGTATTGGCGTTCCGTTGTTTGTC
TATCGATTAATCCTTTGACACGCTCCTTGATTCTGCCATAACATCGTGATACTTCCGTCCAGCTAGTAGCTGCCTGAATACCACCAATAAGTTTTGCTTG
TCGCTGACAG