Description :
From Genome Similarity Track
Location :
contig_4:397036- 399399
Transcript NameFunction/comments
g1140.t1acetyl-CoA carboxylase, biotin carboxylase subunit, partial

Sequence
2363 bases(100 bases per row)
TCTGCACGTCTGCTGGGTCGCGAGGTGCTGTCCGCGCGCAGCGGCGCTTCGCTGCGGCGCCTGCAGCAGGCCGCGGCCCCGCGGGAGAAGCTTTTCGACA
AGATCCTCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCCAGAAGTTGGGCATCAAGACGGTGGCCGTGTACTCGGAGCCTGATGT
AGACTCGGTGGCCGTGCGCATGGCTGATGAGGCCGTGTGCGTGGGGCCCGCGGCCTCGGCCCAGAGCTACTTGAGCATCCCAAGATCGTGGCGGCCGTCC
AGGCCACGGGCGCCCAGGCCGTGCACCCGGGCTACGGCTTCCTCTCGGAGAACAAGGACTTCTGCGAGGCGCTGGAAGCCATCGGCGTGGCTTTCATCGG
GCCTGGACACGCAGCCATCCAGGCCATGGGAGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCAGGCGTCAACACGATCCCGGGCTTCCTGGGCGAG
ATCGACACGCCTGAGGAGGCGGTAAAAAGTGGCCCAGGAGATTGGATATCCCGTCATGATCAAGGCCAGCGCTGGCGGAGGCGGCAAGGGCATGCGCGTG
GCTTACAACGACGACGAGGTGCGCATGGGCTACCGCCTATCCAAGGAAGAAGCAGCCAGCAGCTTCGGAGACGACCGCATGTTCCTCGAGAAGTTCATTG
AAGACCCGCGGCATATCGAGATCCAGCTCATTGCCGACTCGTTCGGTAATGTGGTCCCGCTGCCCGAGAGAGAGTGCTCGATCCAACGGCGCAACCAGAA
GGTGATCGAGGAGGCGCCCAGTGTGCTACTCGACCCGGAGACGAGAAGGGCCATGGGCAAGCAGGCGGCCATGCTGGCCAACAAGGTGGGCTATGTGAGC
GCCGGTACGGTCGAGTTCTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAACACCCCGTCACAGAACTATTTC
TCACGTGGACCTAGTGGAGCAGATGATCCGTGTCGCTGCAGGTCACGAGCTGCCCAAGGAGTTGGTGGATGGACCTGTAAAGATCCACGGCTGGGCGATG
GAGAGTCGCGTGTATGCCGAGGATCCACTGCGTGGTTTCCTGCCGTCTATCGGCCGGCTGCTTCAATATGACGAGCCCGTGCACCTCCCGGGTGTGCGCG
TGGACTCAGGTGTGAACGAAGGCAGCGATATCTCCATGTTCTACGACCCGATGATCTCAAAGCTCATTACGTACGGCAAGGACCGTTCGGAGTGTTTGGA
GCGCATGAAGATTGCGCTGGACAACTACGTTATTCGCGGCCCTGGCAACAACGTTGCGTTCCTGCAGGATGTCTACCGTCACCCTCGCTTCGTGAGCGGT
AAGATTACCACCAAGTTCATCGAAGAGGAGTACCCGGACGGCTTTGAAGGTGTGAAGCTGACAGCACCTGAGATTGAGGACCTACGGGTGGTTGGCGCCA
TCATGCACCTGAAGAAGGCTATTGCCAGCAGCCAAATCTCGGGCCGAATTCAGTCAACACCAACGGAAGGTTTTCCCTCCTTCGACTCGCTCAACAATGA
CGATTTGGAGTTTGTTTCTCATCAAGAGGGAGTTGTCCCGCGCCTGCGTGCTTTCACCCCTGGTCTATCATCGGCGGAGTTGATCGCGATTGCGGAGCGA
AACGACCTCAAGAGTCTCGGTGCTCAGCTGTCGGTTAGCATCGATGGACCATTTGGAGAAGCGAAGCCTGTCGTTGTTGTCGAAGTGGAGCTTGAAAACA
CGCGGCACCGCATGGAAACGGCGACACTCGCTTTTGTCGACAACAAGTGGCACGTTGTGGGCGATGTGGATTGGTCGCTGAACAGTCCGCTCTTCAAGGC
GTCATACGCAAAGCAGAACGGACCCAAAACTGCGCTGGCGTCGCAAATGCTGCAGACGCTGCCCGAGGGATTCCGTCTCCAATTTCACGGAGCAGTCCAT
GATGTCGTCGTACGCAACGAATTGGAGGCTGCGTACGGCATCCACATGAAGCCGAAACCCGAGGTCGACACGTCCAACTTGCTGCTATGCCCGATGCCCG
GCATGCTCATCTCAGTGGCTGTCGAGGTCGGCCAGCACGTGGAGCTTGGGCAGGAGCTAGCCGTCGTGGAGGCTATGAAGATGCAGAACGTGCTGCGCTC
TGAGAAGAGGGGCGTCATCAAAAGCATTGCGCATGCTGCTGGTGATTCACTCAAGGTTGACGAGATCATCCTCGAATACGAATAAGCGCTCTATGCTGCG
CTACAACTGGAAGGTCAACCTAGGCTAAGACGTAGCGGTGCACATGGAGATATGGAAAACAAA