Description :
From Genome Similarity Track
Location :
contig_17:397- 5806
Transcript NameFunction/comments
g3987.t1hypothetical protein
g3988.t1hypothetical protein H257_19374

Sequence
5409 bases(100 bases per row)
AGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGG
ATTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAA
GTTTGGACTGGCAAGAAGCCGCTGCTGGCAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCG
GTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAG
TTCATGGAAGACGTCTTCGACAGTGGGAGACGCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGT
CGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAG
GAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCG
AAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTC
GGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAG
AACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGG
CCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCT
GGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAG
TCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCC
AAGACATGATCTTCGTGGCGCTCTACGTTGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTT
TGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTC
AAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCT
GCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGT
GGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTC
GAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCGACGGAGCACAAGCGGCTACGCGTTCATG
ATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGA
GGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCC
AAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTT
CGACAACGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCGGTGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTC
GAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCT
GTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTAC
AAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTA
GAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAGCCTTTTCGAAGACTGCATCAAGACGTACGT
CACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTC
GAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCATGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGC
TGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCTGCCGTCACCCAAGGTGGAGCACAAGACT
CCGTTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACACCCTGACGCCGAAGGAAAAGGCGCGCGCAA
GTGGGACCCCAAGGCTCACGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGT
TCGCGATGTCAACTTCGATGAGGCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTG
GACGACAACGATGGACCGCGCCTAACGAGCTTCAGGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCG
TTCGCGCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAAACCCGACGAAGAAGAAAAGTCTGTGGGACCAAGA
TGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCT
GTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCG
GCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAA
GCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCC
CTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTG
ACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGACTTCCAAG
TGTCGGCCTTTGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCC
CGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGC
CCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGTGACGACATCCTGAAACCTTCGCCATGGACGAGTGCAAGGGTGGTGAGTCCGGTGGACATG
AGCACTCGACTGGTTCCAAGCAACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGG
ACATCGCGTACGCCGTTGGTTATGTGTCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACTGCAAGGCACC
AAGACGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCAGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTT
CAGGCTATACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCT
CAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAAACGGGACCCGAGCTCATGATCCGCGAAGAC
AACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCG
GTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCT
CGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGG
TCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTGTGTGATGGAAGGTATGATCTTGACACCGAAAGCTTGA
CGGAGCGGAGGGAGGGCAGCACTCGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTT
AGCTCGCTA