Description :
From Genome Similarity Track
Location :
contig_17:397- 5805
Transcript NameFunction/comments
g4960.t1hypothetical protein

Sequence
5408 bases(100 bases per row)
AGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGG
ATTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAA
GTTTGGACTGGCAAGAAGCCGCTGCTGGCAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCG
GTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAG
TTCATGGAAGACGTCTTCGACAGTGGGAGACGCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGT
CGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAG
GAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCG
AAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTC
GGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAG
AACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGG
CCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCT
GGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAG
TCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCC
AAGACATGATCTTCGTGGCGCTCTACGTTGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTT
TGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTC
AAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCT
GCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGT
GGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTC
GAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCGACGGAGCACAAGCGGCTACGCGTTCATG
ATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGA
GGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCC
AAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTT
CGACAACGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCGGTGCAGTTCGGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTC
GAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAAGCATTCCT
GTGTTGACGGGACGCTGATGATGGGACGCAGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTAC
AAGATGGGCATCCACGTGGGAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTA
GAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTCGAAGACTGCATCAAGACGTACG
TCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGT
CGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCATGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATG
CTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGA
CTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAA
GTGGGACCCCAAGGCTCACGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGT
CGCGATGTCAACTTCGATGAGGCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGG
ACGACACCGATGGACCGCGCCTAACGAGCTTCAGGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGT
TCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAAACCCGACGAAGAAGAAAAGTCTGTGGGACCAAGATG
AAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAACCGACGACGTTCCAAGAGGCTGT
GAACGGTCCGGATCAAGTACACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATACGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGC
CAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGC
AGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCT
CGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTGAC
TGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGACTTCCAAGTGT
CGGCCTTTGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGA
GCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCG
GACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGTGACGACATCCTGAAACCTTCGCCATGGACGAGTGCAAGGGTGGTGAGTCCGGTGGACATGAGC
ACTCGACTGGTTCCAAGCAACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACA
TCGCGTACGCCGTTGGTTATGTGTCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAA
GACGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCAGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCA
GGCTATACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCA
GTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAAACGGGACCCGAGCTCATGATCCGCGAAGACAA
CCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGT
GAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCG
GCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTC
CAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTGTGTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACG
GAGCGGAGGGAGGGCAGCACTCGGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTA
GCTCGCTA