Description :
From Genome Similarity Track
Location :
contig_276:397- 2188
Transcript NameFunction/comments
g14440.t1hypothetical protein

Sequence
1791 bases(100 bases per row)
TTTTGTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGACTTCGGACTC
ACCTCGTCGCGCAAGGTAATTACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCCAGAAGACCCCGCCATAGGAGGCGGCAA
GCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACACCGACGACCGCGTGAAGAATACCCGCGTG
GCCGTCACCCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCCGCC
CCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGTAAGC
CGGAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCACCGTGAGTCCACAG
AAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGATCCACTGATCGTGA
GAGTGCCGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCCTCGGGGACCCCC
GCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTCCGCACGCAACCT
CGAAGAAGAAGAAGTCGAAGCCCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGACGAGCAACT
GGAGTCTGCCTTCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAACTGCAAGGTCCA
GTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCTCCTTCGACGCGA
ACGAGCTATTCGACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTCCCGGTTCAACG
TGAAAGACCACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGCTGCAGCGGATGA
CACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGATCCAGCCCAAGCTCCCCT
GAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCGACCAAACCAAGCCACCTG
GAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATATCCGGATGACCTGGGTGTCGACGCTACCCCTCG
TGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAACTGAAGGAATTT