Description :
From Genome Similarity Track
Location :
contig_276:397- 2187
Transcript NameFunction/comments
g14969.t1hypothetical protein

Sequence
1790 bases(100 bases per row)
TTTTGTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGACTTCGGACTC
ACCTCGTCGCGCAAGGTAATACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCAGAAGACCCCGCCATAGGAGGCGGCAAGC
ACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACACCGACGACCGCGTGAAGAATACCCGCGTGGC
CGTCACCCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCC
GCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGTAAGCCG
GAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCACCGTGAGTCCACAGAA
GAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGATCCACTGATCGTGAGA
GTGCCGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCCTCGGGGACCCCCGC
GGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTCCGCACGCAACCTCG
AAGAAGAAGAAGTCGAAGCCCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGACGAGCAACTGG
AGTCTGCCTTCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAACTGCAAGGTCCAGT
GAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCTCCTTCGACGCGAAC
GAGCTATTCGACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTCCCGGTTCAACGTG
AAAGACCACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGCTGCAGCGGATGACA
CTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGATCCAGCCCAAGCTCCCCTGA
ACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCGACCAAACCAAGCCACCTGGA
GCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATATCCGGATGACCTGGGTGTCGACGCTACCCCTCGTG
CCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAACTGAAGGAATTTT