Description :
From Genome Similarity Track
Location :
Scaffold_252:39686- 41019
Transcript NameFunction/comments
Hyaar_Emoy2813200hypothetical protein

Sequence
1333 bases(100 bases per row)
GATAGTGCGGCCTAAGGTGACCGACGTAGGACGTAGGATGCGTGCGCATCTTACATGACAGTTAAATCGTATATGCGTTGCCTAGGCGGCGCAGCTCACG
AAATGAACCGATGAACTTGGGTAATAACTTGTTACTTCCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGATAGTAGGACTAAGTTGCCTTTA
TTGAATAAAAGAACATTTGCCCCTTCATTCTTATCAGCTTTTCGTTTTTGTCGATCTACCGCCTCTGCGATAGAGTCTTGTACGAAACGGACAACCGTTT
CGCGAGCCAGTATGAATTCATCTGCTGACTCGCTATCTTTATCTGCAGTGCTCTTGGAGCATACTGTAGCAAGATCACTTGTCGCCTCTGTGAGCGTGTC
TTTGGACGCACTAGGCGTGATGCTGATTTGATCAGTACCGTGGCCAGTAAGAGCATCTTAGCCCTTACTTTCGTCTTCTTCACCAAAGCCGATGTGAGCA
TCGTGGTGACCGCATTCTTAGCACTTGACGAGTGAGAGCCGGATTGACGGTCGCTCGAATGAGTCTCTCTCATTTTAAAACGAGATTCACATTCTAAAAA
TGTGGGAAGACGCGGATGGTGTAAGCCATTTACGAACAACGGCGTGTGCGTCGTTGACGCATCAACTGAATTGTTAATAGAGAACTCCATCATCGGCAGT
AATTCGCTCCAATTTGTAAAGGAATGGACGTATCCTCGAAGGATCTCCTCGAGGATACGATTGGTGCGTTTGGTCTGACCATCGGTTTCAGGATGGTTAG
ATGTGAACATCTTTAAGCGTGTTCCGAGTGTTTTGAACACGAAACGCCAGAACTCAGCTGTGAACCACGGGTCCCGATCGGACACGAGTTCACGAGACAA
CCCATGAAGGTGAAAGACCGTGTCGATTAAGACACGGACACAAGACTATTAGTTCATTGAATCGGTTACAGCAGCCAGATGTACCACCTTGCTGAACCTG
TCAACGAACACAAGAGTACTGTTATTCTTGTGAGAGTCTGCGGGAAATACAAAGACAAAGTTCATGGATATGGATTCCCAGCACTCGGCCGGGACGGGCA
GAGGCTGCACCGGGGCACGAAGGGAAGGACTAGAATTCACCCGCTGACAGACCTCACAGGCCCGAACGTACTTGTGCACGAACTGATACTGGCGGGGCCA
GTAAAAGTCGCATCTGACTGTGAGATATGTTTTCTCACGACCACGGTGTCCACCAACAAGTGCGTCGTGGTACTCATACACGATACGCAATCGCAGATCA
CCATTATCTGGTACGACGACACCAGGTGTGTCG