Description :
From Genome Similarity Track
Location :
Scaffold_40:396745- 402473
Sequence
5728 bases(100 bases per row)
AGTCGCCCGACGTGAAACGTCGGGTGTAGTGTAGCGACGCAGGTATGTCTAGCGTGTAGGCATCACCCATAACACGTATTAATTTGAATGGCCCAATGTA
GCGCGGCGCGAGTTTGCTCGCGCCTAGGTTCGTAATAGCAGAGGTACGAATTACATCCGTTGAGAGTAATACACGCTCACCAATCTTGAATGCACTTGTG
TTCTTGCGGCCACGTTTGTCAGCGTGTTTCTTCTGCTTGTCAACCGCGAGTTGTAGCGCGTCACGGACGAATCGGGTAACCGATTGGCGATGAAGGACAA
AGTCGGATACCGCTGCCTTGTCAGCGGGTCGCGCTGGAGGTTTCGGCGCGTAGTTAGCCACAGTCGAGTGTGGCTGTGCTGGAGCGATCAGCGTTCGGTG
TGTCCAGTCAACTAACGGCGACGACGTGGATTGCGCGGGTGCGAGAATCTTCTTCGACTGTAAACGCGTCACCGCGTTGATGTCTACTGCAGGAGTAGCT
GAACTCGTAGACGGCAGAACCGTTGTCTCACCGAAAACCGGTGGTTGAACCAGTATCGGAACCGGTTGGGCAGGGTTATCACATTCCTCCCCCTCCAGAG
TGAAGCCATCAGTCGCCGTGGGTTGGCCCACAGCAAGTTGTGCGGGGACACGTGGATGACGCGCGTTGTTGACGAAGAACGGAGTCAATCTCGTCGACGC
GTGTTCGGCATTGTTGAGTGCAAACTCCGCAAGAGGCAGGAAGGAACTCCAGTTCTCGAAGGACGGGGTGTAACTGCGCAGAACATCTTCTAGCACGCGG
TTGACGCGTTCCGTTTGCCCATCAGTCTCCGGGTGCGCCGCCGTCGACATGAGGAGTTTGGTGCCCAGGAGGTCGAAGAGTTTCGTCCAGAACGCCGATG
TGAATCGGGGATCGCGGTCAGAGACGATTGATTCAGGAAGGCCGTGATGTCGGAAGACAGCGTCGACAAAGTGCACCGCGGTATCGGCCGCGGTGATTGA
GTCCGGAACCGGAACGATATTACACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGACCGCCAGTATCGGGTGGGAGACCGAATATGAAG
TCCATTGACACAGAGCGCCACGCCTCTGTCGCCAGAGGGAGAGAACGCAGCGGAGCTTGCGATGACGGTGACGGTTTAGCGCGTTGACAAGTTTAGCAGG
AGCGGACTCGCTTGCGCACCCACTTGTATAGGTGAGGCCAGTAGAAGTCCCGGGATACCGCTGCGAAAGTCTTCTCACGGCTCAAGTGGCTACCCACTGG
AGCGTCATAGAATTCGTGTATAATTCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGCATCGAATCGATCGATACTGTACATCAGCAGA
TTACCGTCAAGTTGGTATCTGTGAGTCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGCCATCACTTGGTGTGCGAAGGTGTTCCAGGATACCGG
CATATATCGAGTCATCTCGATACGCGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATGCCGCCGTCATCAGGCTCACACCTGCAGCCACACATGT
GCCGCAGTCCAATTCGTCGTCGTTCGCGTCTTCAAGTGACTGACGACCCAAATCTCGGCGATCGTAATCGGGGCGCCGAGATAGGGCATCCGCAAGGATG
TCATTCTTGCCTGGCTTGTAGTGAACGACGAAGCTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAGATGAGGGCTCTTCGTCGCTG
TTCGCAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAATTTGATCAGTGCGTAGCGCATAGCAAGGAGTTCCTT
GTCGTGGACCGGATAATTCTTCTCAGCGGGCTTCATCTGTCTGGATTGGTAACTCACGACGCGTTCGCGACCTTCGTCGTCGAACTGCATCAGTGCACAG
CCGATGGCGAAGTCGCTCGCGTCGCAAACAATGTGGAATGGCTATGAGTCATCTGGAAGCACCAGGATTGGGGCCTCCGCCAAGCTTTTCTTCACTGCGT
TAAAGGCTGACTGATGTTCGGGAGTCCACGACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGGCTGGATCAGACCAGCGTAATTTTTATGTACTTG
TGGAGATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAGATGGACGAGACCTTCTCAGGATCCGCTCGGA
CACCATTTTTGCTCACATAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAGTTCGCGTACAGTTGGTTTCGCGCATGACTTGG
AACACTTGTCGTAAGTGATTCAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGTCATCGAAGTAGCTCGGAGCGAAGT
CGCGAAGTGGGCGCAGAACGTGGGAAACCAAGCGATTGAACGTGGCTGGTGCGTTTTTTAGGCCCTGCGGCATGACAAGCCACTCCCCCAGCATCCCGCT
GGGAATGCTCACCGCTGTGAGCGGGATGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATGGCGCTGAAGATAACACTGCGGCCC
ATGGTGTCAAGTACCATATCCTTCCGAGGGATCGGAGTTTGTGCTGGGATGGTGGTGTCGTTTAGCTTGCTAAAAGCGTGAACAATTCGCCAACCACCCG
TGGCCTTCTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCCCGCACGTGACCAGCTTTGCTGCGGCTCTCGGAGAAGTCGTCAATGGCTGT
TACCTGATCGCGTGGGAGGGGCCACTGTCGCGTCACACAGTACTTGGAACCCGGCGTGAGATCAATCTCATGGCGAATGCCTCTGTCAGCAGGGAGCTCA
GCTGGAATCTTGTCAGGAAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCACGACTGGGCAGCGAAGC
GCTCTTCGCGCGCCGACTTCGGCTCAGCGTTCTTTGGACGAAGTAAAAGATTATCGGTAGCGACCGTGTAGATCTCTTCCGCCGAGGCAGACTCGGTGAT
CAAGCAGACCTGCTCGATGTCTCCTGACTTCAGATCGCGCAGAAAATGCTTCCAGGAAAGTCCCGGAAGGCGTGTGATGGAAGAAGCTTCGCGAGGTGAG
CGCTCAATGTCAAGTGAGCGTGAGCGAACGGCGCCTCCTTTCACGTGTTCCAGGACGTGTATGGACTCATTCACTGCAATATCGGCGGTGGGCTGACCAC
GTCGCTTAAGACGGCGTCGCTCGGATTTCTTCTTGTGGCGTCTCGAACCGCTGCTCGAGACAGAAGACTCGCTATCGCTGGACGAGGGAACACCCCCCTC
TAGACACGGAGGGGCGCCATCAATCGTGTCGGTAAGGCGCGGGAGCTCTCGATGCTCGACCGCGCCATCGACTGGCGAGAGCCCCTCGATCGCCGTCGTA
GACGGTGGGAGTGTCAACTGCTCGACCACCGCTGTGGATGACCGGGAGCTCCAACTGCTCGACCGCCGAATCGCGTTGCGGGAACCTCTGCTCAACCGCT
AGAGTGTTTTGCGGGAACCCATGCTCAACCGCATTGGTGTGTTGCGGGAACCCATGCTCGACCGTCGTGTTGCGTGACGGGAACTCATGCTCGATCGCGT
GTTGCGTGACGGAATTCATGCTCGAACGCCGTGTTGCGTGACAAGAACCCATGCTCGACCGTCGTGTGCGTGACGGGAACTCATGCTCGACCGCCGTGTT
ACGTGGCAGAGAACCAATGCTCGACCGCCTGCTCGGATTGCGGGAGCCCCTGCTTCTACCGCCAAAGTGTTAACAACCTCCCTTCGCAGCGAGGGGTTTT
CGCGCAACAGCGCTGTGCAAGGCATACAGAGAGGGCCATCGCTCGCTCTCTGCTCAACCTGCATTGTGGACAACCGGTCCACGACCCTGGCATGGGGCTA
GTCCTTCTGGACAACCAGGAGGTGCGTGAACACCTCACTCACATCGAAGCCAGAGCGGTGTCTAACCGACCGAGCCAACCAGTCAATCTCTGGTTGATAT
CTTGACAACCACGGGATACTCAAGATGCAGTCGAACGCGTAGTTTATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAAGAAGTCGAATGTGTACGGCA
ACGTGATCTCGCGCCGCGCAACGCGGCGTGGCTTTCCGTCAGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACTGGGATCTCTCTTGGAAGCAT
CGATAGGCACGATTCGCGAAAGAAGTTATTCGACGCTCCTGAGTCCAGGACTGCGCGAAGTGGTCGCCGGGCGCCGGCGACATGAAGACTGACGATGATC
AGCCTCGCGTCGCCCGACGTGGTGGTGGCATTAAAGTGTGCGTGGAGCACAGGAGGGCTAGAAGGTTGGGTAGCCACCGGGGAACCCGGACCTCCATTCC
AGCCAGTAGGGCGCCCCGCACCTACTGGCCCTGACCGTTGTTTGACTGAACGGCAGGTGAGACTTCGGCGGTGTGCGCGAGTACCGGCGCTGGCGCACGG
CATTCCGCCGCGCGGTGACCGATTTTCCGGCAGCGGAAGCAAGTGAGCGGGCGATTAGGACGGCCGTTGGGCCCACCTGACGGTGACTATTCGACGCGTC
AATCGCGTCGATCTCCATGGGCTCGGGGGCTGACTCACGAGCTGCCGTAGACATCACGCGCGCGTAAGACGCCGCCACAACGTAGTCTTCGCGTAATGCG
AGGGCGAATGCTTCCTCGAGAGAGGAAGGTTCCGCTCGGGTCAGGCAGTACTGAGTCATGCCTTCACGCATGCCGAATACGAATACATGGACCGGCGATG
CTGTGTCAATCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATAGTCATTTTACCTTGACAAGGGCGAAGAACTCG
GCACGCACGCGGGATTCGTCTTGAGGCGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTT
TGCCGAGGGCCCATTCCTTGGCCTTCCCGGACAACCGGGACAATAAGAAATTCACCTTTGTCCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTC
GATCTCGCGAAACCACCGGTTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGAAGGTAGACGTCTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCG
GGAGTTGTTGCTCGCCGATTCGCATCGGCTAGCTCGCGTTCCATGAACTCTTGGGCTGCTTGGCGTTGTTGGTCAGACGTCGCTGAGCTCAGCAGCGACG
CGATTACAGCCTCACCAGACACCGCCGCGAGGCGGTGAAGGGCTTTACACTCACCACGAGTGAGATGAGGGAAAGCAGCATGTTCCAGGGTCGGCCCTGG
CGTTTCAGACGTCATACCTTGGCTCATCGTGAACTTGGTCATGGAAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCTGGGGTGTTCGTTACTTGCTT
ACACGTAGTGATGAGGAAGCGTACAAGT