Description :
From Genome Similarity Track
Location :
contig_5:3966- 5415
Transcript NameFunction/comments
g1602.t1POM81867.1 Transposase [Phytophthora palmivora var. palmivora

Sequence
1449 bases(100 bases per row)
CACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAAAGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGGACTTTGCGCA
CACGTTTACGGCGTCCACAGTGCGGGCGCGACGCGAAAGGACTTGGTGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCACGAAT
GGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGCCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAAC
GTCGCGGGCACTGGGCTGCAGTTGGAGCTGACCCTGGCGATGATGGCCAAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACTGTGTTATTT
GGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAACATACTTTAATC
AAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGCTGAGCAACTC
TGCACAATCACTACTGAGAAGTAGGTCGGCTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATCGCTGTCGGGG
ATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTGAAGAGGCCAT
TAGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGCTACAAAGACA
AACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACTGTCCTTGAAC
ATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTATACCAGTTGCATCCACTGCTGCGG
TTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTCAGATACTAATTCAGTGACAAACGT
CCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCCACTATTGCCAAAGCCAATTTTTTA
TGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCATGTGTCGATTGTATTGCAGGATAC
AGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGAC