Description :
From Genome Similarity Track
Location :
contig_7:39659- 40746
Transcript NameFunction/comments
g2315.t1XP_009532586.1 hypothetical protein PHYSODRAFT_515363 [Phytophthora sojae

Sequence
1087 bases(100 bases per row)
CGGCGGAAGCGACTACGAACCTCATGGACGCTCGCATTTTACTGTCCGTGCTCAAAGTTACAGTACCGCTAGTCAGTCGACCGCCTGGAAGGTATTTAGC
CATTTGAACTTGGAGACGTGAAGCCACGTTTCCAGTCCCTTTGCCGGAGCGCATCAGGGTTCCCCGAACCCAGGCAGATTGGCAGAGCGATTTGCCGCAT
TATTGCTGACTGGATTGGGCATTTCCCCGCATTCCCTGCGAAGTGCCCTGCATAGACCGGGGCTGCACAGCACGAATTGGATCTCAGAGGCAGCATATGC
CGCCATCAACATGTGCCGCATCAACATGTGCCTCACGACGTGGCTCACGACGTGGCTCACGTGAGAGAGAGTCGCTACAAGGACTCGGACGCATTCAGTG
GTGAAGCGAAGGCGAGCGCGAAGTTCGCGACGGAGACTGACTCATGCAGTCTTTTGGTGAAGTGACAACCGTGGGGTCACTGGCGAACGCATTTTGTCGT
TGGCCGACACTGCAAAAGTCAACATTCGGGTTACACTGTACTGTAGTACCGGAACTGTATTTTCAAGACAGAGCGAGTCAGATTCCGACCAGATTGCCTA
CCGTTTTGCTCTTAGCTTTCGTGCTCAGAACTGTCAAAATCTAAGAGGTAATCAGATACACACAGGTTCTATTCAGAGGTAGACACGTTGCAAAATTACC
CCAGGTTTATACTTACTACTAGAGGTAAATGTCTTTCAGCGCAACAAATCTTGGTTCATGTGCTCACATGGTAAGGAACTCCAACTTGTATACGCCGAGC
AGTGACAGCATCGCTGATGCATGTGCACACAATCTAAAACTGCTGGCGGATGTACGGCCTTCCTTCGACTGCGATACGGGTCTATCAAGTCCAGAAGCGT
TAGCGACATTGATAACTCTTGGCATTGTTGGTTTATCCAGCTAAGCGACAAGGCTCCCATTCCAACAATGGTCGCCTCAATGAGAGTCCTACTCGCAGCT
TCCGTCGCTTTCCTCGCCTCCACGACTGCCGTAGATGCAACGCACCGCCAATTGAAAGGATCACTGGCCGACGCCCCATCCGTGAAG