Description :
From Genome Similarity Track
Location :
contig_163:39658- 42611
Transcript NameFunction/comments
g11849.t1PREDICTED: uncharacterized protein LOC101063318, partial
g11850.t1reverse transcriptase

Sequence
2953 bases(100 bases per row)
ACAAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTG
ACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTC
TCGAGGCTGCAATGCGCTTGCAATGCAAGAAGAGTTTAGCCTAGGCTAAATGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCGTCGG
GAGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGT
CACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGC
AGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAG
AAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGGACTGTGGAGCGTCGAACAACTTTGTC
GACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAA
GCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATG
CGTGGCTTGCACGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGG
CGCAGCACATGCACCACGTGGTGCATGCGGCCTCCATCAGAGGCAGCGCGGAATGCGGCTGTCTCCGGTCACCGAAGCGAACGCCAACGACTGCGAGAGT
CGTTGGAAGAAGATGTGAAATGAATCAGCAGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATG
TCGACACACATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCATCGGCTCTGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCA
AACGTCCCGCACCGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTA
AAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGC
GAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCT
TGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAA
GCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCA
TCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTT
GCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTAT
GCTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAA
GTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCGCA
GACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATG
CGTGAGAGTGATATCCTCTACAGCGGTAAGCACTCGCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGCTGAAGAACGCCCCAGCGACGTTC
AACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGAACGACGTGTTCATCACGCCGGGCTGTGAATGGGAATCGGAT
GTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGCGACCGAGAT
ACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAA
CTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGGGCTGCA
TGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCA
CGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCG