Description :
From Genome Similarity Track
Location :
contig_163:39654- 42620
Transcript NameFunction/comments
g14499.t1hypothetical protein
g14500.t1hypothetical protein

Sequence
2966 bases(100 bases per row)
CCCCGCTACAAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGA
ACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCC
AAATACTCTCGAGGCTGCAATGCGCTTGCAATGCAAGAAGAGTTTAGCCTAGGCTAAATGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAA
GGCGTCGGGAGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAA
ACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAG
GGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTC
ACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGGACTGTGGAGCGTCGAACA
ACTTTGTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGA
ACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGT
TGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGG
CCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGGCAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACG
ACTGCGAGAGTCGTTGGAAGAAGATGTGAAATGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGT
CGACAGATAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTCGAGGTAAAGAAGACGCATCGGCTCTGGAGCCGACGCTGCAAGCAGT
GCGGACGGTTGCAAACGTCCCGCACCGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGT
GCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGT
GAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAG
ACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAG
TCACAAGCTGGAAGCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAG
CTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCT
TTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCC
GGGAACGAAGTATGCTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAG
TGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCATCGTTCATGCGTATAACAAGCTGAACGATGCGA
CGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTA
TCAGATCCTCATGCGTGAGAGTGATATCCTCTACAGCGGTAAGCACTCGCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGCTGAAGAACGC
CCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGAACGACGTGTTCATCACGCCGGGCTGTGA
ATGGGAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTC
GGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTC
AAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGCAAGATTCGCCCGCTGTCGCAGCTCTTAA
AGAAAGGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAG
ATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCG