Description :
From Genome Similarity Track
Location :
contig_163:39651- 42618
Transcript NameFunction/comments
g13975.t1hypothetical protein
g13976.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
2967 bases(100 bases per row)
CCCCGCTACAAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGA
ACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCC
AAATACTCTCGAGGCTGCAATGCGCTTGCAATGCAAGAAGAGTTTAGCCTAGGCTAAATGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAA
GGCGTCGGGAGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAA
ACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAG
GGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTC
ACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGGACTGTGGAGCGTCGAACA
ACTTTGTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGA
ACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGT
TGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGG
CCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGGCAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACG
ACTGCGAGAGTCGTTGGAAGAAGATGTGAAATGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGT
CGACAGATAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCATCGGCTCTGGAGCCGACGCTGCAAGCAGT
GCGGACGGTTGCAAACGTCCCGCACCGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGT
GCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGT
GAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAG
ACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAG
TCACAAGCTGGAAGCGTTTCGCTCGCGACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAG
CTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCT
TTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCC
GGGAACGAAGTATGCTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAG
TGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCATCGTTCATGCGTATAACAAGCTGAACGATGCGA
CGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTA
TCAGATCCTCATGCGTGAGAGTGATATCCTCTACAGCGGTAAGCACTCGCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGACTGAAGAACG
CCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGAACGACGTGTTCATCACGCCGGGCTGTG
AATGGGAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTT
CGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTT
CAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGCAAGATTCGCCCGCTGTCGCAGCTCTTA
AAGAAAGGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAA
GATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCG