Description :
From Genome Similarity Track
Location :
Scaffold_499:3965- 7711
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_499-snap-gene-0.6DEAD/DEAH box RNA helicase
Pytar_ATCC12531maker-par_contig_499-fgenesh-gene-0.2High mobility group protein B1
Pytar_ATCC12531maker-par_contig_499-snap-gene-0.9Guanylate-binding protein, N-terminal domain containing protein

Sequence
3746 bases(100 bases per row)
TCGTCGTGCTGTGCGACGCGGGCGACATCAACACGGAGCACTACAACCCATTCGAGCGCCGGCAGCGGTGCGTTCTGTTTCGTTTGCGTTTGGACAGGAG
GAGGATACTGACGGTATGATACTGCTGCAGCCCGAATCGCATCACCATCTACGAGCGGCGTGAAGGTGGCAGCGGCCTCGTGAAGGAGATCCTGGAGTCG
CTCGCTCTCATCGTCACTCGCGCACACCGCATTACGCTCGAGTGTGCGTGCCGCAGCGGCTGTCCGTCCTGCATCCACTCGGCGCAGTGCTCCGAGTACA
ACAAGGTGCTGGATAAGCGCGGCGCGCTGCTCGTGCTGGCGTTTCTCGCTGAGGCCTACGGCGCTTAGAATGAAGAGGGACGATGTCTAGAATCTAGAAT
GAAAGGGAGATTGATTGTGGGGGTTTTAAACTCAGAGCGTCGAGAGCCCGATGCCTTCAAAGCCGCCGTCTCCTCCGAGCTCCATGGCGGCGGCCGCCAG
CGCCTCCTGCTTGTCGTAGTTGGTCGTCTTTCGGCCCGCTGCCTTTTTCCTGGAGCTGCTCGCGGTCGGAGACTTGGATGATCGCGTCACATTCTGAGAA
AGTACAGACGCACACCAGCAACATAAAGTCAGACCTAAGCATTGACGAGGGACTGAGTTGCTCGACGCACAATGGCCACGTCCAGCTCCTTGCAGAGCGC
CTCNNNNNNNNNNGCTGAGCTGCTCGACGCACGATGGCCACGCCCAGCTCCTTGCAGAGCGCCTCGGCCTCGGCCCACTTGAGCACGCCGTACTCGAGGC
ACCACTTCTTGGCCATGCGGCTCTGCGGGCGCTGCTGCAGTAGGCTCTCGTAGAAGACGCGGTCCGCAAAGCCCTGCCATGTTGTCCGCAGTGGTTAGTC
CTCTTGGCGCGGGTCTAGCAAATCCCCCGCCAGCGCTTGCGTCTCCGAGACGTACCGGAGACGGCGTCGGGTGCTTCTGCCCGGGCTTGCGGTTCGCCTC
CTGCTCCTTGGACCACTCCTCTTCTTCGATCATGGCGGCGGCGGCGGCTTCTGATGATGAGGGTGAGATGCCCCTAAAAGCAACACGCTCCCCACTAAAA
CCGCTTCCTTCGGGTCGTTCCAGCTAAATCCGCTTTGGTTATATTTCTGGGATTACTTTCGGCTAGATGTACTGTTGCCATCTTGGAAGATGGCAAGAAG
ATGTATTCCTGATGGGAGAGGTGCAGTAGTGTTACCCCTTCAGGGCCGATATCCGCTTTCANNNNNNNNNNCAGATGTACAGTGTATTACTGTAGCCATC
TTGGAAGATGGCAACAAGATGTCTTTTTGATGGGAGAGGGGCAGTAGTGTTACCCCCTCAGGGCCGATATCCGCTTTCANNNNNNNNNNTGCTCTCCGAA
AACAATTCAATTGGGTTCTTTTCACGAACCTAAGACGAACCTCATTGCTCACACATACCCCCACATGCGAACCTAACGGCCGGCCCACCACTCTGGTCGT
CTCGCTTAGCTGCCAGAGGTAGTGTCCACGGGCGGAGCACACGCTCACTCAACTCGAGAACTACGGGCGGCACACCGTCCGAGCCGACGTGCAACGCAAA
GCCCGTCGACGTCTCGGCCTCCTGAATGAGCCGCGCAAGCGCCGCGCCACGTGGGTTAGAAGCCAACTCGCGGTTTAATCGGGCTTCTCGAAGCAGCTCG
CACTTGCTGCCGCGAAAGACTCCGCCCTTGTCACTGTGTGTGTAGTTGACAATGGCTGCAAATACACCGTGCTGGCAATGGGCAATTTGAGTGTGTGTGA
GAGTGAGAGTCGGGTAAGAACGGTACAAGTGAGATATATCATTCTACGCACATGGAACAGACGTATGGCGACGTCATGGCTCCTGCTGGTGGATCCAGAT
CTCGTCAGCCGTAGCACAAGGATAGGCGCGCCGATGCTGGTGTTGGGCAAATTCTGACCCTGGCGTGGGGAATCGCTGCGCGGTTGGAGTAGTGGTGAGC
GGGACAAGGCGGGGAACGCGAGCTGCAGCGCACGCGCGGCACGGCCCACGAGTTGCTGGCACGCGTGCGAGCTTACCTCAGCATAGTACTCTCCTCTTGC
CTTTAAGAAATCATGCTGGCTGGCGGTCGTTAATGACACTCCAGTCTCTGCGTTCACCACGTGGACGTGTACCATCTCAACCTCCCCCGCCTTCCCAAGC
GTCTCAACAGGCAATGGATCCTCCGCAACCTCCAGTAGCTGCATCACAACGTGGTGGTGGAAATCTTGGAACATCTCCATCGTGCCTTCGCCCCCATAAT
TTCCACGGCCTTGTTCTCCGTCCAGCGCACTCGTAAGGGTATAAGCCTCGGCCATTTGCTCTGCCTCCAGGCGGTTCTGCTGGACGACATGCTCGACCGA
CTGTCGGAAACTGGCGATAAACTCGCGCAGAACCACGAGACTCGCGAGTCGCGCGCACTCTGCCAGTGCAGAGGCGCATTTCTTGTAAATGACTGCACAC
GCGACGCTCGCGGCCGTGTCTACTGACAGCACGACGCAGTATCCGTGCTTGAGTTCGAGGCGGGCATAGTCTTGGCGAGGCGACGCAAACTGGAGCAGAC
TCGCCAACAACAGTGCAAGTTTCGGGAAACGGAACGGGAGCGTCGTGTCGCGTTCGCACTGCAGTAGCACCCGCCCCATGGTCGTGAGCACCATGGCGCA
CGCGAGGGGGGAGGATACGCAAGACGACTCGGTTGCCATTCTGTGACAATGACTCTAGAACGACGCGTCGCTTCAAGAATACTAAACCAGTGAAACGATC
GAAAATAGTTGAGAATTAGAGAAAAGCGTGGTGGTCTGTTTTACTGTGCCTTGCACATCTCCGTGTCGCTCCGCGTTCCGCGCGTGGCGCCTACCGCCGG
GGGCGACTCGGCGTCCGGTGACTTGAAGAGAAACTCGCGGCTGCTCGTGCGCAGGGCCGAGACAACGGCAAACGCTGACTCCAACTTCGGCGCTGTCGTT
GTAGTCGCTGTGGTCTCTACCGGTGTCTTCGTGCCCGTGGGAGACTTGGCCGCCCTCGCGGCGTTCTGGCTCTCGTACGCTTGGAGCTTATCTTCAAGCT
CTTGGATCTCCCGCGCGACGCGGTCCATGTCGGCTTGCACGACTGCCTTCTTCTTCGTATACGCGAGCTTGAGCACGCCCGTGTCTGTCTTGGCCTGCGA
CCGAAGTTGCCGCGCAAACTCGGCTTGTTCCTGCTTGAGCTCATCTACGCGTTTGGCGTGGTCACTTTCGATGGCAAACACTTGCTGCACGTGCCGCGTC
TTTTTCTGAACGAGTTCCCGTTCCAACTCCACGACACGGGCGAGCAGTTCCTTTTGCTGGGCAAAGAGCGTGCGTTCTTCCTTGTGATGAGTGCGTTCCT
TGGCCAGCATCTCGTCGGTCGCACCAGTCATGGTCTCTTCAAGGCGCTGACGATCGGCCATAGCCTGCTTTTCCAATTCTTCCGTGCGGCTGCGCACCCA
CGCCAAATCACTGGTCATGGTCCGGATACGCACTTCTTGCTTGGCGTCCATTGTCGTCATGTCACCCATGAGACGATCAAGTTCGTTCTTTTTCGCGTTC
AGCTCTCCTTGCAACGCACGTCGCAGTTCTGAGAGCTGCTGCGTCGACTGCTCGAGCTGTTCCTCGTACAGTTTCTTTTGATCGTCGGCCGAGAACGCCG
CGCTCGTGTCTTGCTGCTGCGCGAGTGCAAGTTCTTGGTCGAGTCC