Description :
From Genome Similarity Track
Location :
Scaffold_440:3965- 6246
Sequence
2281 bases(100 bases per row)
ACGACCCACCGTCTGTTTTACCTCCCGATAGGGGTGTCCGTCATGAAATTAACTTGGTTCCTAGGACCAAGTACTGCATTACACGACAGTGACAATTGCC
AAAGGAACAACGTGACATCATTGATGACTCCTTTCGTGCCAAGCATGAGGCAGGAATGGTACGTGAGAATAAATCTGCACATTCGGCACCGACATTTGTG
TCAAAAAGCTGAACGGCAAGTGGCACATTGTTCATGCTTACAACAAGCTTAATGCGACCACCATACCGGCACAAACACCAATTCCTAGAAAAAATGTTCT
TTAGTAGAACATAGTTGATTGTATTATGTATTGTGCACTCGACTTAGTCTATGGATATTAACAATTGCTCATGCGAGCGAGTGATTTTCCGCTGACGGCC
GTGAGCACTCCAAGTAGTATGCTATGGGAATGGTTGGCGCTGCCATAAGGGCTATCTAACATGACGGCTACATTTAATCGTCGAGTGACGTAACTTTTTC
GTCCCCATCGGGATTAAGCACAGACGTACTTTGATGACTTTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGAAAATCACATTGGTCATTT
GCAAGCCTTGCTTGAGTGCATGCGCACTAATACATTGTGCGCCAACGCGTCTAAATGCACTTTTGGTGCAGAGGAAATTCCCTATCTAGGATGTTTCATT
GGTATGCGCGGCCTTCGAGCAGATCCCGCTAAGGTCAAGGCTATAGTGGACCGGCCGATTCTTAAGAATCAAAAGGATTTTCGTAAGTGGCTTGGCCTCA
CAATTGTTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACCGATCTCCTTAAAAAGTACACAGATTGACGCTGGGACAACACCCAT
GCTGACGCATTTTAGGCACTAAGGAGAGTCTCCTCCATGTTTTTAATTTGGCGTTGCCAAACCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCCCA
CTTTTCCATAGGCAGTGCTATGTTACAAACAGACTCTGCAGGCCACGAGGGAAATATAGCATTTGAATCTCGTCAGCTGAAAGCTGCTATAAGGAACTAT
CCAGTTCATGACAAAGAGCTACTTGCTATGAAGTATGCACTTTTCTAGCTTAGAGTTCATCTGCTCGGCTCCAAGCCATTCGTCGTCTACACGGATCATG
CGTCATTACGTACGGCGACACATTCGCCTCACCTCTCTCAGAGAAGGGCTCGTTGGCTTTCGTTCTTTGCAGAATAGAACTTCGAGGTGAAGTAGAAACT
GGGGGGAAAAGTTTGTTGGCAGATGCCCTATCTCGTCGTCCCGACTATGAGCTTGCTCATGTCACGAACTTGTCGTCTCCTATTGAGTAGTTAATTCGTG
TGACACATCCACGGAATTCTCAATGGGTGGCATTATTTTATGCCCTTGGGAGTACAAAGACTCGGAAATTTATTAATCGACACAGTTCCGTGCCAGCTTA
CATCGACATTTCATAGATAATGGTCTCTTGTTCTATCGCACCGATGTAGCGGAAACTGCTCTCATTGTTGTACCTCACGATGAGGATTTGAAGTATCAAA
TCCTCTTTGAGGCCCATGACACTGCTCTCGGTGGGCATATGGATCGTGAAAAGACTTACGGATTTGTGAGTCAACACTTCTGGTGGCCTAAACTCTACAA
ATGGGTGAGCACATACGTGTATAACTGCAAAACGTGCCCGAGGGTCAAACCCTCAGCACACTCGGGTGCGCCACTCGCCAGATTACCTGTGCCCACGGGG
TGTTGGAAGTCCATCAGTATGGATTTTGTGTTTGGTCTTCCCAGAGACTGTGACGGCAATACGGGTATTGTGGTCTTTGTAGACCGTTTAAGCAAGATGG
ATCACTTGGCGGCGGTGCTGGATTCCGTCGATGGCAAAGGTACAGCTATGCTGTTTATCCATCGTGTGTTTTGTCAACACAGGTTGCCGCTAGCAATCAT
CTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGAACTTCCGTCTTCAAGGTGCTTGACACGCGATTGGACATGTCCACAGCGGATCATTCGCAGACC
GATGGTCAAACTGAGAGGTCAATCACGTCATCGGAGATGTTCTTCGCAGTGTTTGTGGTGAGTTGCCAAAGACTTGGAGCTTGATGCTCCCTGTCTTCGA
ATTTGGTTAAACTACGCTGTACATGCCTCGACCAGCTTTGCTCCCTTTAATGCGAATAGCCTCACGTACCCGCGCGTTCCG