Description :
From Genome Similarity Track
Location :
contig_45:396442- 397454
Transcript NameFunction/comments
g9531.t1hypothetical protein

Sequence
1012 bases(100 bases per row)
GGAGCTTGGACACTGGCAGCTGGTACTACAACGGCAAGGCGTACCAGAAGTACGCGTCATTGTGTTTGATGGCCGCCGACAGCTCAGTGGTGGGAGATGA
CACTACACTCCTGAGTAGTTGTTTGTCGAAGCTGGAGACACTCATCGAACCTTTTGTCAGCAACACGCTGAGCGTCCCATTGGTGTACGAGACAACGTAC
AAGGGCATTGTGACAAGCCAGGTTTTCACTAACAATGATGTCAACGTAGAGTTTGGTAACGGAGTGTACAACGACCATCACTACCACTACGGCTACTGGA
TCACAGCGTCGGCCATCCTGAAAAAGCTGGATCCGACATGGTCAGGCATGGCTCAACTCGAGACGATGGTGTGGACGCTGCTCCGCGATGTGGCCAACCC
GAGCTCGGAGGACACACACTTCCCCAAGTTCCGCCACTTCTCCTGGTTTCTGGGTCACTCCTACTCGCACGGCGTGACCCCCATGGCTGATGGTAAGGAT
GAAGAGAGCACGTCGGAGGATGTGAACTTCTACTACGGTATGATGCTGTGGGGCAAAGGCGGCGGGGAACAAGGCGGTGGAGGACCTGGGGAGCCTCATG
CTGCGCCTCAACGCGCGTACAGTGCGCACCTACTTCCTCATGACGTCGGACAACACGATTCACCCGCCTCAGTTCGTGCCCAACCACGTCACGGGCATCT
TCTTCGACAATAAGGCGGACTACGCGACGTGGTTCAGTGCCGAGAAGCACTGTATCCACGGCATCCAGATGATCCCTGTGTCACCGATCAATGGTCTGGT
GCGCACGACTGCATTCATTCAGGAGGAATGGGATGACATCCTGTCGAAGGAGGCGATTGTCACGGGTGACAACACTAGCAATGCGTGGTTGTCACTCCTC
CTTGTTAACGAAGCGGCGATTAATCAGGCAGATGCGCTGTCAAGGCTCACGACAGCGACCATGGACGACGGTCTCACCCGTTCGTGGGCCTTGTACAATG
CCGCGTCTCAGC