Description :
From Genome Similarity Track
Location :
contig_45:396433- 397444
Transcript NameFunction/comments
g9994.t1hypothetical protein

Sequence
1011 bases(100 bases per row)
GGAGCTTGGACACTGGCAGCTGGTACTACAACGGCAAGGCGTACCAGAAGTACGCGTCATTGTGTTTGATGGCCGCCGACAGCTCAGTGGTGGGAGATGA
CACTACACTCCTGAGTAGTTGTTTATCGAAGCTGGAGACACTCATCGAACCTTTTGTCAGCAACACGCTGAGCGTCCCATTGGTGTACGAGACAACGTAC
AAGGGCATTGTGACAAGCCAGGTTTTCACTAACAATGATGTCAACGTAGAGTTTGGTAACGGAGTGTACAACGACCATCACTACCACTACGGCTACTGGA
TCACAGCGTCGGCCATCCTGAAAAAGCTGGATCCGACATGGTCAGGCATGGCTCAACTCGAGACGATGGTGTGGACGCTGCTCCGCGATGTGGCCAACCC
GAGCTCGGAGGACACACACTTCCCCAAGTTCCGCCACTTCTCCTGGTTTCTGGGTCACTCCTACTCGCACGGCGTGACCCCCATGGCTGATGGTAAGGAT
GAAGAGAGCACGTCGGAGGATGTGAACTTCTACTACGGTATGATGCTGTGGGGCAAGGTGACGGAGAACCAGGCGGTGGAGGACCTGGGCAGCCTCATGC
TGCGCCTCAACGCGCGTGCAGTGCGCACCTACTTCCTCATGACGTCGGACAACACGATTCACCCGCCTCAGTTCGTGCCCAACCACGTCACGGGCATCTT
CTTCGACAATAAGGCGGACTACGCGACGTGGTTCAGTGCCGAGAAGCACTGTATCCACGGCATCCAGATGATCCCTGTGTCACCGATCAATGGTCTGGTG
CGCACGACTGCATTCATTCAGGAGGAATGGGATGACATCCTGTCGAAGGAGGCGATTGTCACGGGTGACAACACTAGCAATGCGTGGTTGTCACTCCTCC
TTGTTAACGAAGCGGCGATTAATCAGGCAGATGCGCTGTCAAGGCTCACGACAGCGACCATGGACGACGGTCTCACCCGTTCATGGGCCTTGTACAATGC
CGCGTCTCAAC