Description :
From Genome Similarity Track
Location :
Scaffold_16:39641- 45531
Sequence
5890 bases(100 bases per row)
GGCTGGACTCATACGCCTGGACCACATTCGGGACGTCCCGAAGGAGATTGGCGCGAGGCTCCCACGTATCCTCGTCGGGAGGAAACCCGAGCCAACGTAC
CCGATAGCGACGGTCGGCTGGAAAATCGTGGGCGAGCCCACGATGACGTTTGGGAGCGCGAAGTGGATCTTCGTGGGCAACGATGTACTCAACAATCCAG
CGGGTATCTCCGGCAGCGTCAACAACAGGAGGAGGGCCGTCGCGTCGATAGCACTCGCGCTCTGGCTGCCCAGAGCGAGAACGACTTGCTGAACAGCTAC
TGGGATGTCCAGCAGGGGTTGGATGAGGCTCTCGATCAGACTGCCCGGGCCACCGGGGAGAGTGCGCAGCTGCGTCAGTCGAGCCGAGAGATCCTTGCTC
GGTTGCAGATGCTGGAGAGGTCGGTTCACGGACGTTTGCAGACGGGGACGCAGCCTCGAGATCCGACTCCTGGTGTGGATGGGTCGATGGCTCGCCGCGC
CCGTCGAGAAGGTCGCTCGACGCATGCTCTGGCTCAGTAGCCTGAGACGACTCTGGAATCGTAGCGGGGTGATACTTCTTGAGCCGTCCGACGTAAAACG
TCGGATGCAGACGTAGTGACGTAGGAATGTCAAGCGTGTAGGCATCACCAATGGCTTTGATTACCGTAAATGGCCCAATAAAGCGCGGCGCGAGTTTGTT
CGCGCCGAGGTTGGTAACCGCAGAGTTTCTGATACCTTCAGTCGACAGGAGCACGCGTTTGCCTGTCGTAAACGTGGCCGTGTTCTTGCGGCCGATCCTA
TCGGCGTTCTCCTTCTGCTTGTCCACTGCATCCTGCAGTGCGTCTCGAACATAGCGGGTGACCGCTTGGCGCTGTAGTACGAAGTCGGAGACGACTGCGG
AGTCGATTGGTCGCGCCGCATGCTTCGGCGCGTAGTTAGCTGGCGCAAGTGAGCTCGATGCGGAGCGTGTCACTGCGTTGACCGACGTGGGAACAGGGGA
TACACTCGAGATATCATTAGCAACCGGTGTATGTACCGGTTGACCCAGTACCGGTGTAGCCGCCGGAGACATCGCAGATGGAGTAGACGGCTTGTCGGCA
GCTTCTTCCCCACCCAGAGTGGAGACACGCGGCGCTGTGGGATGGCCCACGGCGAGGAGAGCAGGGACACGCGGGTGTCGCGCGTTATTAACGAAGAAGG
GCGTCAGCCCAGTCGACGCGTGTACCGCGTTGTTCAGAGCGAACTCGGCCAGTGGCAGAAACGAGCTCCAGCTGGAGAACGACGTCGCGTAGCTTCGAAG
GACGTCTTCGAGGACGCGATTTACGCGCTCCGTCTGGCCGTCCGTTTCCGGATGGGCTGCTGTGGACATCATTAGCTTCGAGCCCAGTAGCTCGAAGAGC
TTTGACCAGAAGGCCGACGTGAAGCGCGGGTCGCGGTCGGAGACGATAGATTCGGGAAGGCCATGATGACGGAAGACAGCATCGAGGAAGTGCACCGCGG
TATCTGCTGCGGTGATCGCATCCGACACCGGAATCAGGTGAACCATCTTGCTGAAGCGGTCTACGAATACCAAGCCATCTGATCGTCCTTTAGCATCGGG
TGGGAGCCCGAAGATGAAGTCCATCGACACCGAGCGCCAGGCCTCGGTGGCCACTGGTAGAGGACGCAAGGGAGCCTGCGAAGACGAGGCAGGTTTCATG
CGCTGGCAGGTCTCGCAGGTGCGCACCCACTTACGCACCCATTTGTACAGGTGTGGCCAATAAAAGTCGCGTGACACAGCGGCAAATGTCTTCTCGCGAC
CGAAATGAGCGCCCAGCGGGGCATCATGAAACTCATGGATAATCCGTGAGCGCAGATCGGGGTCGTTAGGGACAACGACACGTGGGGCATCGAAGTTGTC
GATGCTGTACGCCAGCAGCTCGTCCTCGAGACGATATCGGTGGATTTTGTTTCGTACAGAGCGGGAAAGGGCTCCCAGTATGTCGGCGCTGGGAGAGCGG
AGATGCTTCAGGATACTGGAGCACGTCGAGTCATGTTCGTAAGCAGCTCGGATCTCGTCGCGAAGTGGCATTACCGGGGAGACGCTCGTCAGGTTGACGC
CTGACGCCTCGCACGTGGCACACTCGTCTACATCGTCTTCATCCAGCGAAGCTTGTCGACCCAATGCACCGCGTGGGTCGTAGTCGAGACGCCGAGACAA
AGCGTCGGCGAGAATGTTGTTCTTGCCGGGTTTGTAGTGGACAACGAAGTTGTACTCGGAGAAGAACGAAAGCCAGCGGGCCATCCGCTGGGAGAGATGA
GGACTCTTCATCGCTGTCCTCAGCGATGCATGATCGGTGTACACCGCGAAGGTATCCTCACCCAACAAGTACACTCTGAACTTGATCAGAGCGTAGCGCA
TCGCAAGGAGCTCCTTGTCGTGAACAGGGTAGTTGCGCTCCGCCGGCTTCATCTGCCTAGACTGGTAGCTTACGACACGCTCTCGATCTTCTTCATCGAA
TTGCATCATCGCACAGCCGATGGCGAAATCGCTCGCGTCGCAGACGACGTGAAAAGGCTTCGAGTCATCCGGGAGCGCGAAGATTGGGGCCTCGGCGAGA
CTCTTCTTCACCGAGTCGAAGGCGGCTTGATGTGCGGAAGTCCACGACCACGACACATCTTTCTTCAACAACGAAGAGAGCGGCTGGATCAATCCGGCGT
AATTCTTCGTGTACTTGTGGAGATAATTTGCGATACCCAGCCACTGACGCAGTTCAGTGGGATTCTGTGGCGTAGGCCACGCACATATCGACGACACTTT
CTCGGGGTCGGCGCGGACGCCGTTCTTGCTCACAAAGCAGCCAAGCACCGGAATCTCCGGCGCGCAGAATATACACTTCTTCAAGTTGGCATACAGCTTG
TTTTCGCGCATCACTTGGAAGACTTGCCTCAGATGCTTCAAGTGGACTTCAAGCGCGCTGAGGCCTCCCTCAGCGCGACTGTGTACGAAGATGTCATCGA
AATAACTCGGTGCGAAGTCGCGGAGCGGGCGCAGCACATGGGATACCATGCGATTGAACGTGGCGGGAGCATTCTTCAACCCTTGCGGCATAACAAGCCA
CTCCCAGAGCATACCACTGGGAGTGCTTACCGCTGTGAGCGGTATATCGCTCAGCCTCATGAGGATTTGGTAGAACCCATCGGTCAAGTCGATGGCGCTG
AAGACCTCACTACCCGACATTGCGTCGAGCACCATGTCTATCCGAGGAATCGGCGTCTGGGCAGGGATGGTAGCGTCGTTTAGCTTGTTGAAGGCATGGA
CGATGCGCCATCCGCCCGTGGCTTTCTTCACACAGAAGGTCGGACTGGAGTGCGGCGATGTGCTCTCACGCACATGACCCGCCTTGCGGCGGCTCTCGAA
GAAGTCATCGATAGCTTGGACCTGATCTCGCGGGAGCGGCCACTGCCGCGTCACACAATACTTCGAGCCGGGCACGAGATCAATCTCGTGGCGAATTCCT
CGGTCAGCTGGCAACTCAGCTGGGATCTTATCCGGAAATACATCTTCATATTCGCGGGCGGTCTCGTAGACTGGATTGCCGGATTCGCGTAGCGCGTCCC
AAGACTGCGCTGCGAAGCGCTCCTCGCGGGCCGACTTAGGCTCAGCGCTCTTTGGGCGCGAGGGAGCGTCGCCGTCACTGACTGCATTCACTTCGAGCGA
CGCCGAATCGGCGTCGGTGATCAGGCAAACCTGTTCGATTTCATCGTCCTTGAGGCCGCAAAGGAAGTTCTTCCAGGAGAGACCTGGAAGTCGAGTGATC
GACCCTGCCTCGCCAGGCGGGTTTGCAAGCTCGAGTGTTCGTCGGCGGCCAGAGGTACCTTCCACATACTCAAGCACGCAGACCGACTCCGTCGGTGAGC
TGTCACTTGGTACGGGCTCTCGGCGAGGTTTCAGCCGACGCCGCTTCGACTTCCTCTTTCGCCGCCTCGAGTGCGAACTCGAGGATGATGAGTCGCTCTC
GCTGGACGAGATGTCACCCCCCCCTTTAGCGGGAGCCCCTGCTCGACTGCCATCTCGTTCGTCTGCGGGAGCCCCTGCTCGACCGCCATCTCATTCGTCT
GCGGGAGCACCTGCTCGACCGCCGTCTCGTACATCTGCGGGAGCCCCTGCTCGACTGCCAGTTGGTCTTCATCCCCGCGGCGCCGCGGGGACTCGTCAGT
TAACAGCACCGCGTCGGCCGTGCAGAGAGGGCCATCGCTCACTCTGTGCACAACGTGCGTCGTGGATGACCGGTCCACGACGGTGACGTGAGGCCAATCC
TTCTGGGCGACCAGGAGGTGCGTGAACACCTCGCTCACATCATAATCACTGCGGCGCTTGACCGACCGGGCCAACCAGTCAATCTCTGGTTGATAGCGCG
TCAGCCACGGCATACCCAGGATGCAGTCAAACGCGTAATTCATCTCAATGACGAGGAAGTCGTCGTTGCTTCGGAAACCGTCGAACGTGTACGGAAGGGT
AATCTCGCGCCGCGCTACGCGGCGTGATTTTCCATCGGCCAACTTGACAGCGACCTCCCCTCTACCTTTGCGGACAGGGATGTCCGACGGGAGTACCGAC
AAGCACGACGCGCGGAAGAAGTTGTTGGTCGCTCCTGAATCAAGGAGCGCTCGCAGTGGTCGCCGGGCACCGGCGACATGAAGACTGACAATGATCAATC
TTGAATCGCTCGGCGTGGTGGTGGCATGAAAGTGTGCATGCAGCACAGGAGGGCTAGGAGGTTGGGTTGCCACCGGGGGACCCGGACCTCCATTCCAGCC
AGTAGGGCGCCCCGCACCTACTGACCCTGACCGTTTTTTGGCTGGTCAGAACTCACGGGCTCGGCATCGACATGCGCAAGCACTGGAGCTGGCGCGCGGC
ACTCCGCCGCGCGATGACCGACCTTCCGACAGCGGAAGCAGGTGAGAGAACGATTGTTCCGAGCACCGCTCCGACGCGCTGCATAACGCTGACGATTGCT
CGTCGCATCGATAGCGTCGATGTCCATGGGCTCGGGCGCAGAATCCCGAGCAGAAGCAGGTAGCGCGTGAGAGTATGACGCCGCAACCACGTAGTCCTCG
CGTAGGGCGAGGGCGAATGCCTCTTCGAGCGTAGAGGGGTCCGATCTTGTAAGGCAGTAGCGCGTCATGCCTTCGCGCATACCGAACACGAATACATGAA
CCTGAATGGCCATATCGATCGGCTTAGACACGATGCACGACGCGAGGTGTCGTGTCTTCTGGACGTAGTCGCGCATAGTCATCGTGCCTTGCCGAAGGGC
GAAGAAGTCTGCCCGAATTCGGGATTCATCTTGCGGCGGCTCGAACGCGAGCCGAAGGTCACTCTGGAGGGTATCCAGAGTGGGGAAGACGTTGGGATCG
ACAACCAACTTGCCGAGAGCCCATTCCTTGGCTTTCCCAGACAGCCGCGAGAGGAGGAAATGGACCTTCGCGGAAGGCGCCTCGATCAACCTCGAGGCGA
TGGCGATGTCGATCTCTCGAAACCAGCGATTCAGCGGAAGTCGATCTCCTCCGGCACCGGAGTAGGTGGACGTCTCTAGCTTCACGACGTCATTCGTGGA
GATACGCGAGGGAGTTGACACTCGCCGATTCGCATCGGCGAGCTCGCGTTCCATGAATTCTTGTGCCGCAACGCGCTGCTCGTCGGGCGTCGCTGAGCGC
AGCAGCGACGTGACGACGGCTTCTCCGGACACCGCCGCAAGGCGGTGGAGAGCTTCCCACTCGATCCGAGTGAGATGGAGAAAGGCAGCGTGGTCGAGGT
CTTGGCTCATGTCGAACTTGGTCGTTGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCAGGTATTTACTCCGTTACTTGCTTACAC