Description :
From Genome Similarity Track
Location :
Scaffold_497:3964- 10583
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_497-snap-gene-0.3Dynein heavy chain

Sequence
6619 bases(100 bases per row)
TCGCGTTTCTCATCCAGCTCTTGCGATTTCGTGGCCGACTTTTCCAGCGCGAGCTCGATCTCAGCGCTGGTCGCCTTGGTCTTGGTCAGCGACTCGATGA
GCAAGACGTTGTCGAGGATGTCGCCCTCGGACGTCGCGAGCGCCTCGACGAGTTGCTTCTCCAGCGTCGCCAATTGCACTTTGCAGTCTTCCTCTTGTTT
GAGCAGCTCGCTCTTTTCCTGCTCTAGGGCCGGCTGCTCGTGGTGGATCGTGACGCCCAGGAGCTGCCCTTCCAAGCCCGACTTTGTGACGGTGAAGTTG
ACGACGTTGACGATCGCGAGCGCGTCGGGCGCGAGCGGGGGCGACGGGTTCCGCGTGACCAGGAAAAGTCGAAAGTTCTCGTTGTAGTCCACGACCTTGT
CGCCCAGTGCCACGACGTACCGCGGGCCCTGGTGGATTAGATCCTTTCGCACGAGCGGGTACAAGTACGGCTCGACTGTGTCGACCTCCAGAATGACCAG
CGTGCGGCCAAAGCGGACTGCTTGCTCGACCGTATTGACAAAACGTGCGTCCTGCGCCTGCAGCAGCGTCAACGGCCGTGTCGTTTCTTTCTCGAGCTCG
GCCTTCAGCCACGCTGTTGAGGCACTCGCCGGGTCAATGATAAATGGACAGCGCTCTGCACATGAGTGAACCACGACCAACGCGTTCTCCATTGAGAGGT
TGTCGGCTGGAAGCCCCATGCTTTTCCATGTGAGCAGCTCGCTTTCCGTACTCATGAGCTTCCGATACTCAAAGCTTCGCGACGCGCTCGATGACGACGA
GATCTCGAGCATGTCGCGCTCCCATTCTTTCGTGATGGACTCCCGGACGTCCTCGGAGCATTTGCCCAAGAACGTCGTAAACGCCGCGGCCAAGAGCATG
CGCATGGCCAAGTCTGACTGCCGCAGTTCGAGGTCCTTGACCTGCTCGGACCAGCGCGTCTGCTCGCCACTCAACTGCGAGAGCAAGCCCTGGGCTTTTG
TTAGCGTACTCTCGGCGCGCTCTAGTCCATAACGAAGCTTCTCGGCCTCGGCCGTCTTGTCGGCAAACTGTGTTTTCATGTGGGCGACCTTCTTGTCAAT
GGTCGCGAGATCAGACTCGTACTGGTGGAGCTTTTGCTGCGAGGTCTCGAGCGACCGTTTTGCCTCGGCGAGGTCAGCCTCCAAAGGCTCAATCTTGTTG
AGTACCATCGAGTACTTGAGATTGGCTTTGACCCACGTGGCGAGCGGCGCCGCGGCCACGCTCACGCGCGTGATCGTGTCGTGGTCAAAGGACGCGGCCT
TGCTTTTTACGAGCTTGCCCACGGCCTTGGAGATCTCGCCCGTGATGCGGTGCGCATCATAGTTCAAGATGTCTTCTTTCACGCCGCGATTGCCCAGGAA
TTTCTTCATGGAATTCCACGACGTGTCTTGAATGCCCAGCAGCATGAGCACGGCCGAGAGCACGTCGTGGATGGGCTCAGGTGGCATCTTCAGTGACCGG
ATCTCGTTGATATTGTCACTCTTGATATTGCCCACGGCGTCTTTCGCCGACTGCAAGATGGGCGTGATCTCACTCAACTCGGTCTCGATCTCTTTCTTGC
GGGCCGCCGTGGCCTTCTCCGCCTCGGCGAGCTGCTTCTTGAGCTGCTCGACGTTCGAGCGGTGGGTCGCGGCCTTGTCGAGTGCCTTCTGGATCTCGTC
CATGGCCGTGTCGGCCGCGACCTGGGCCTCCCCGAGTTCCTTCTTCTTGATGCGCGCGTTGCGGCTCAGCTCGTCCACGGTGCTCGCGGCCTCTTCGAGC
TTACTCAGTCCGCTCTTGAGGTGGCTGATCTCGTGTTGCACTTGCTTGGCCTTGGTCTCATACAAAAGCCTCCACGTGCCGAGAAAGCCAATGAGTTCGC
GGGGCGTGGCACCTCCTGACAGCGACCGCTGGCACGTCTCATAGACGCGGCGGATCAGCGGCAGCGTCGTCGGTAGCACGTCCAGCAGATCGGATCCCGT
GAGCAGCATCTCGGGGATCTCGTTCCGGCTCTGCGGCGACCACTCACCCATCCACGCAATCGCGCACCGCGTATACAGCGCTGGATTACTCTCGCAGCGC
AGGACAAACTGCGAGTGGCGTGCATCCATGCCCAAGACAATATGCACGTATTGGCGGACACGCGCCACGAAAAAGTCGTACACGGTCTTGATACTGGACG
AACTACTGGACGAACCGATGGCGTCGAGCATCTTCTCCTTGAGCGGGGTGATGAGCGGCTCAATCTCGTCGTGCGTGTATAGCCCCGGGACTTCGCCCGA
GCTCAGCAGCGAGTTGGTGATCTCGAGGATCGCATCGTCTTGCGCAAAGTGGTGGTCTTCGAGATACAGCACGACGTGCTGGCCCTCGACGCCGGCCTTG
ACCAGGAGGCTCTTGAGATCCGTGCGGAAGCACGCGGCGTCGTACTGGCGCGTTGCGCTTGGCGTGAAGAACGTGTAACCCAGCAAGTACGCCACGAGCG
TCGTGGCAGAGCGGCGTCCAACGCCGGCATTACCCACGAGCAAGAGCGCACCGCCGGGTTCGGACAGCACGCGCTCGACCACGGCCACGTGGTCTAAGAT
CTCGTCGAACAACAGCATGTGGAGATCTTTCTCTTCGCGCTCGTACAGCGTCATGCCCTGTGCAATGGCCTGGCGGAAGTCGTCGCTCGCGATGCGCACG
AGCGGCGCGGCCGTGGCGGCGAGCTCCCCTGTCTCAGTTGAGCTGCCCGCGCCGGCTTTGCGGCCGTGGAGCGAGCTGAAGAAGACGTCGTGGAGTTTGG
CGGTGTGGCGCCACTGCTGCTTGAGCACCAAGTTGACGAGGCCGTCGAACTTGCTCGCGCTGTCTTCATCCACCAGGCGATCGCGGAAAAGCCGTCTCGC
TTCATAGGCGATGATATCCAAGACGTCGTCGCTTGCGAGATCGTACCGCACGAGCGCAAAGACCCACTTGGTGAGATCGCGTGGCGTGAAGAGGTAGTGA
CGATGGTCGTCCACGGTGAATTTCGTGCGCGTCGCGTCAAAGATTTCGACCATAGAGCGCGCAAGCTGATCGCGCTTGTCGCGTCCGTCTCGCCACGCCG
ACGCCACACCCGGATCGTTGAATACGGCCTCTAAAAAGGTCGAGTAGACGACCTGCAGCTCATCGGACGATGGGTAGTCCATATACGCGACGCGTACGAT
CGCCGTGAACCGCGTCGAGAGCGGGTGGCGTCCCACTGTCGTCGCGGCATTCATGCTCGCGACGATCTGGATCTTGTCAATGCCCAAGAACTCGAGGTTG
GCGTCGTAAAAGCCGTGGAACGTGAGAAGCTGCTGCAGGAACGCGATGAGCATGCACGTGTCATACTCGTCGGGCTTGGGAAGGTTGATGTCTTTGAGGT
AAAGCACGAGCTTTTCGCAGTCGCGCGGGCGGTAGACGCGTCCAGAGGTCGTGGAGAAGAGCGAGCAGCATTGCGCGATCTTGTGGATAATGTGATCGGC
CGTGGTCTGAGCGTTGCAGTGAAGCACCGTGACGTTGACTTGCTTGGCCGTGCGGAAGGCCTGGCGGATGAGCATGTTTTTCCCGCAGCCTTCAGGGCCG
ACAAGAATGAAGGGCGCCATGGTGTCGACCCACGGCGCAATGGTCTGGAGACCTCGCTGCACCGAGACGGTGGGCACGACGGCATCTTGGCACGCCGCCA
AGTCGCTCCGGTCGAGCTTGCCGTCAAGCGCGCCGTAGGTGTCGCGCTTGGTCTCATACGAGTGGAAGACCGAGCCCGTGCAGTAACAGTCGAGTGGCGC
GCCAATGTCGGGCGGTCGCTCGCTGCTCATCATGAACAGCGCCTTGGCGAACGCCGTGCGGTGCGCGACCGAGAGGTTCGCGCCGAGCCCACGGATCATG
GCGACGACAAACTCGGATCGCGAGGTCGCCGTCGCGACGTGGCTCAGGCCGTTCAAAATGGTGCCGACCGTGGTCGTGTCGACGACCAAGTCGAACTTGC
CGAGCTCTTCGAGCGCCTTGGCAAAAAGCTCGTCGATCCAGAGGCTCAGGTTCGCGCGCCTGTCTTCCGGTTGCGACAGCAGCCACTTGCTCACGAGTCG
CTGGACGTCGACGTCCTGGTCCGACAAGAAGATCATCCCCATGCGTGAGATGGTCGCCGGTGACGCAAACTTGAGGTCGTGGGTCTCAAAGACGAAGTTG
ACGTTCGGGCCAAAGTTGATGCGCTCGCCGTTCGGCAGCGTGAGCAAGTGGTTGTCGTCCAGCACCGAGTTGAGCGACTCGATCCACTCGGGGTCGACGT
CGCCGTCACAGATGATCCACGACCGCACAGACTCGGGCTCCTTGACGACCTTGCGCGCCGCGGCCGTGAGCACGCCGTCGAACCACTCGCGCGTGTCCAA
GTCCATGTGGCCCAGCAGGCGTTCCCGCGGCATGGACTTTGGATTCATGACGTGCGTCTTGACGAGCTGGCCGCAGTGGATCAACGCGGCCTGGAGAATC
TGCCACACGGCAGACTTGCCGCTGCCGCTCGGACCGACTACGACGCAGCCCATGCGCTGATCGAGCGACTCTTTGAGCTGCAACATCTTCCGGATCTGGA
GCTCGTCGACTTGGAGGCAAAAGGGCTTGGCCACCATGACGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGTCGGCCAGAACGCCGCC
TTCCAAGTCTGTCGAGTTGACCCCGGGAAACACGTCGCCAATGAGCGCGAGGAAGCGTGCCGCGTCCACGAACGTGAGCTTAGACAGCGTGTTGATGCGC
ACGGCCTTGATCAGCACCTCGGTCTCCTCGGCGGGCGTCATGCGTTCACTGCTGGCCTCGGCGCGTTGCTTCTTGGCCGAAGAGAGTAGCTTCCCGGCGG
TGTTGAGCACGGCTTTGAGCGCACGCAGGCCCCAATCATAGTGTTGCTGCTGCGAGAGCAGCTGCGCCGACAGCGCGTAGAGCGACACGACGCGGGACGC
GATCTCCTTTGCCTCGGAGAATCCTTCCGAGTACAGAATGACCTCGGCAATGAGGTTGTTGTCGGGCCGCCCCATCGCGACGGGCCGGAACAGCGCCTTG
AGATTGTCGGGTAGTTTCGACCGACCGCCGTACCCCTTCCCGGCCGGGTTGAGCGTCACGAAGATGCCGGCATTGAAGTCGACGTCGACGTCGCGGTTGA
GCAGCTTGATGTGCTTGGTCTGGTCCTTGATGGCGTCTTGGATGACCTGGATCTGCTGCGAAATGGCCGAGAGCTGATCTTCTTTCAAGCGGTTGAACTC
GTCAAAGCAGCCCCAGGCACCGCACTTGACAAGGCCAATGAAGATGCGGCCCATGGACTGGAAATCAATGCCTTCGTCACAGTTGAAGACGAGTACCTGG
CGACCAAACTGGCCACCCAGGGCCTTCACGGACTCGGTCTTGCCCGTGCCGGCGGGGCCGTACGGGTTGCCGCCGAAGCCCATGTGCATACCCTGCGTGA
GCGTGAGATAACATTTGTCCGTGAGCGGCGTGTGCACGAGCTTTGGGGCGTTGCCTTGGTACTCGTACGTGTAGTCAAACTTGGCGTCGTTCATCTGGAT
GACCACGCGGTCGCTGTCTTTGCCCGCCAAGTAGAAGCGGAGCTGTTTCTGCCAGCTCCAGTCTTTGACCGAGTTGCAGTTGGCCGCGAGGAGCTGGTCG
CAGACGTCCATGTGGTGCACGAGATCCAGCACGAGCGCCTTGACCTTCAGACTCAGCAGCGGCTCGGTGGTGAGGTCGAGCGACGTGAGTTCCCGCAGCG
TCTCCTGGAGCGATCGCTTGAGGTCGCTGACGCTGCCGTTCTGGATCGCGGCCTCCGCCTGCTGGCAGAACCGGATCTGCTCGGCGAGACACAGGACCTG
CGACGGGAACTGCGTATAGTCGGGCGCCTTGCTCGTCACGCACTGGGCCACGAGCACGCGGATCGTGCGGCGCATTTCGTCGGTGAAGGTTTCGAGCCAC
TCTTCGACTTGAGCCGTCACGGGCACGGGCTTGTGGAGCGGGACGGTCTCATTTGCCGAGCTGCACATGGCAATGATCTGGTCCTTGGCTGCCGAGAACT
CGACGCGGTGGACGCCCTGGTAGAGCTTCTTGAGGTGGCTCTGGATCACGAGCGGGTTTTGCGACTGGCCGAGAATCTCGAGCAGGTCTTCGTCGCCAAT
GAAGTAGAACCGCGGCATGCGCGACCGCTTCTCTTCAAGAAAGTCGGCCAGCGCCTTTTGGCACCGCTCGAGCTGGTCCACCATGACGGCGAGCCGGTCC
AGAAGCTTGGGGAACAGCAGCTCGTCGGCCAAATTGAAGAGCAGCGCGTCGCTGCCGTCGAGTGTCGCCATGATCTGCACAAACTCCTTGTCGACATTGT
GGAACCGGCCCTGCTCGGATGGCAGCGCACCCTTGGAGAAGATGGGTTCGAGAAAGACCCACTTGCGCTGGATCACGTTGAGCTGCGTGAGTGCCTGGTC
GAGCACGTTCATTTTCTCTTCGTACTGGCGCGCCTCTTGCTCAAACGGCTTGAAGAACTGTGAGTCATTGAGTGACGCCAGCAGCGACTGGTTGTCACCC
AGTTCCAGTAAAATTTCTT