Description :
From Genome Similarity Track
Location :
Scaffold_991:3964- 6493
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_991-fgenesh-gene-0.2Replication factor C subunit 4
Pytir_DAOMBR486maker-pir_contig_991-fgenesh-gene-0.3WD domain-containing protein

Sequence
2529 bases(100 bases per row)
CGATCATGTTCCAAGTCCGCGCGCCAAAGTCCGATGCCCCACCTGCGTCGCTGCCATGGGTGGAGAAATAGTAAGAGACCTAAAGTACTTGCATGTACAT
GCACGCGGTTCTATATATGTGTGAACGTGCTGGCTCACCTACCCTCTCTCTCGTTGTCATTTACTTTGTGCACAGCCGACCAAAGAACGTGGACGAGATT
TCCCACCAGGAGCACGTCGTCGCGACGCTCAAGACGTCGATCGCGAGCGGCCAGCTGCCGCATCTGCTCTTCTACGGACCACCAGGCACAGGCAAGACCT
CCACGATTGTTGCGGTGGCGAGACAGCTCTTCGGTCCTGACTTCCGCAAGAACGGGCGATTCCTGGAGCTCAATGCGTCCGACGACCGAGGCATCAGCGT
CGTTCGTGAGAAAGTCAAGGGCTTTGCGCAAGGTGCAATCAGTGGCTCGAGCAGCATGCCGCCATTCAAGATCATCGTGCTGGACGAAGCAGACTCTATG
ACGAACGACGCGCAGTCCGCACTGCGACGGATGATGGAGAACTACTCGAAAGTGACGCGCTTCTGTCTCATCTGTAACTATGTGAGTCGCATCATCGAGC
CTGTCGCATCACGATGCGCCAAGTTCCGCTTTGCGCCGCTCGAGAAAGTATCGATGGCATCGCGCATCCGCTACATTTGCCAGGAGGAAGGCATCGTGTC
GAGCGCCGAAGTGATTGACTCGCTCTTGGACTGTTCGAACGGCGATTTGCGTAAAGCGATCAACTTCCTGCAGAGCGCCAAGCAATTGTGTGGCGACGAA
GACCTCTCGAGTGAAGACGTCATCGCAGTCGCTGGTGTAAGTGCCATGTGTGTGTGTTTTGATATACTATGCTGTGCTATTGACTGAACTAACCTCATCT
ATTCATGTCTGGATAAAATGAATGACAGCTGGCTCCTCCTGAGCTCCTGCAGCTCTTCTGGGAGTCGGTCACGTCCAACAGCTTTGACCGAATGAAAGTC
GAGATTGAGAACATCCTCATGTCGGGCTACCCGGTGCTGACGATCCTCAAGCAGCTCAGCGACGACGTGCTCGACAACGCGAAGCTGAGCGACTCACAGA
AGGCGAAACTCTGTCTGCGGATCGCCGAGGCCGACAAGAAGCTGGTCGACGGCGCGAGCGAGCACTTCCAGCTGCTGGACGTCGCGTCCTACATCATGCG
CGTTTACTACTCCTCGTGAGAGAACCAATCCATCTCAACGGGTACCAATCAAAGGAGCAAAGGATAATTGCTGCTTGGCAACTATGATTGAGTCTGACGA
GGATAAGAAACGAACCGACCAGGCCAGGCAGCAAAGCATAGCTATAGCAGAACTATCGCGCGATTATAAAGCAAACTCTAGTGATCTACAATAATGTCTT
TCTTCCATTGCATTTGTATTGATCATGCACTCAGCAGCATTATGTTGAGTCCTTTTAAAGAGGGTCATTACTTCCCAGTCGGCGCGAGCCAAATCAGTCC
ATCACCTGCGCGCCGTGCTCGTTCACGGACGAAAGCTGCACCCACTCCTTCTCGCTAATCTGCTTCCAGAACGTGACTTCGTCGTCGCCCACCGCCACGC
TGAGCACTGTGCCCGTCAGCGACCAGCTTATCCGGTACACGGGCGAGCGGAATGTGTGAACCACGTGCATCTTCCAGTCCCCGTCGATCTCGTCCTGGCT
CCAGACGCGCACCGTGTGGTCATCCGACCCGGACGCGATGATGTTCGCCGGGATGCCAACGTTCGGCGCCCACGCCACGTCGCGCACCCAGTCCTCGTGG
CCCATGAGCGAGTCCTCCGTCAGCGTCCACTGGTTCTCCTGCGCCGCGAACTGCCAGATCTGCACCGCGCTGTTGGTCGAGCCTGTGACCACGCGCTGCA
CGGGACCCTGTGAACCCTGCGAGCCCAGCGAGTTGTACGGCGCCCAGCTCACAGATGTCACGCCCGCGCCGTCTTGCGAGTTCATGAATGACGAGGACGT
AACCCAGCCTTCGCGCATTCTCGTCAGGAACGACACTTGACCGTCCGCCGACGCGCTCGCGAGGCAAAGTCCGTACTCGTACGGTGCCCACGCGATGCTC
ACCACCGACAGCGAGTGGAACGTGTGCACGTACTTGAGGATCCACTCGGTCGCGCCGCTGCCGTTCGGGTGGAGCTCTTCGCGGTAGACGAACACTTTGC
CATCCTGACACGCCATCGCGAGCAGACTGCCGAACTTTGGATGCGCCCACGCGATGCGGTGCATCGGCGCATTCGAGTCGTCGGGGAGCTGCGTGATGTG
CTGCAGCACGTGCGCCGCAAGCTTTGGCCCGTTTGGGTCTGCCGCAGGCTTCGTCTTGTTGTCTTGTGACGGCACCGTGGCTTCCGACACGTCATAGACG
CGGAACGTGCGGTCGCCCGAGCACGTCACGAGGCGCTTGCCGTAGTAGTCCAGCTGGATGTCATTGATCATGTCGTTGTGCTCCGTGTCGATGCTCGTGA
CCGGCGCTATGCGCTGCTGCGTCTGCTGG