Description :
From Genome Similarity Track
Location :
contig_5:3964- 5413
Sequence
1449 bases(100 bases per row)
CACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGGACTTTGCGCA
CATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCGCGAAT
GGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAAC
GTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACTGTGTTATTT
GGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAGCATACTTTAATC
AAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGCTGAGCAACTC
TGCACAATCACTACTGAGAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATCGCTTTCGGGG
ATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTGAAGAGGCCAT
TTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGCTACAAAGACA
AACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACTGTCCTTGAAC
ATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTATACCAGTTGCATCCACTGCTGCGG
TTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTCAGATACTAATTCAGTGACAAACGT
CCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCCACTATTGCCAAAGCCAATTTTTTA
TGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCATGTGTCGATTGTATTGCAGGATAC
AGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGAC