Description :
From Genome Similarity Track
Location :
Scaffold_118:3963- 5666
Transcript NameFunction/comments
Phyag_g2313hypothetical protein PHYSODRAFT_332774

Sequence
1703 bases(100 bases per row)
TGGGTCACGCAGCATCCGGACTATACGAGTCATGTATTGCCGTTGACGGGGGCGGCCCAGTGCCAACGCCTGTGCAAATTGATACTGACGGAGTTGAGAC
TGGAGCTCGATGTTTGCGCCAAGAAGCAAGAAGACAGTTCTCCTGTGGTGCTACTGAGTGCGAGAGAGAAGTTAGTACCTCAAGTTATGCGGGCAAAACA
GCTTTTTACGAATGTGGCACTGTATCCGCTGCATCGAGATGAAGCGAGACGACAGTTGACGAGACGATGGGGAGCTCAGAGTTCGTTGGCTTTGCCTCCA
TTGCAAGATATTTACGCGTACTTTGGACCGAGGATCGCCATGTATTTTGCTTGGTTGGCGTTTTATACGAACGCGTTGGTACTCCCAGCGGCCTATGGGG
TGGTCGTGCATGCATTGGGACTTCTGAAGTTGGCGCCGAGTTATACGGTGCACTGCGTTTTGGTGGCGGTTGGCACGTCGCTTATTGCGGATAtgtggag
acgacgacagcgggAGGTGGAGTTTAAGTGGGGGTATGATGGCGTACTGTCGTCGTTGCATTCCACGACGAGACTGCAGTTTAGAGGTGAATGGATGCAG
GACCCGGTAACGGGACAAAGATGTTTCAACTTTCCACACCATAAACGACTGCTACGACAGCTTTTGGCGATTCCATTGTTGGTGTCAATGTGCTGTTTGG
TGGGAGGGTATGTAGTTGGACTGCACGTGCTCTCAGAGCGTCTACGAGCGATCTACAGTGACAGTTGCGCCCAAGCATGGGCGCAGGTCGAGACGAGCGA
CGGGTATTGGGCGTATATACCCAGTAACGAAACGATGACCTGTGCATTTGTATCACACGGCCCGAGTGTGATTAATGCTGTGATCATCTACGCAATGGAC
AATTTGTACCAGTTGCTGGCACGGAAGCTGACGGAGTTTGAGAATTATCGTACTCTTGACGAGCACGAAGCGCACCTGGTGGCCAAGCGGATGCCATTCC
ACCTCGTAAACAGCAACGCGTCTCTTTGGTTTCTCGCTTTTTACGTGCAGCGCTTGGATCGAGTTCGAGAGCGACTGTGGATTTTGCTTGTGGCGACGCA
GTTGATTGACAACTTCAAGGAAGTAGGATTGCCGCTTGCAGTGTCTGTGGGTGGCCAAGTGCTTACTGCGGAGAATAaacggcgtcgtcggctgAGCCAC
GAGAGACTTCAGAATGAGGTCATTGAAGGTATCAACCGTCTGCAGCGGAAAAAATCCATGCCTTATTTGAAAGCAAAACGTGAGCGAGTAGATGTGGCTA
AAGCTGCTACTGAACAGCGTTTGGCGCGAGTACTCATGCAAAAACGGCAGGCTACTTATCGCGATACCTTCGCTGACTACAAGGAACTGATGGTGCAGTT
TGGCTACGTAACTCTCTACAGTCCAATTTTCCCACTCGCTGCGGCGTTTGCTTGGTTGAACAATATGATCGAAAGTCGATCTGACCTACTCAAACTGGTG
AACCGCCACGGCTACCAACGACCGATTGCACAGCATGCGCGGGGCATTGGTGTTTGGGAAAAGGTGCTGGTGAGTTTTGCGGGGGTGGCTGTTGTCGTGA
ATTGCGCCCTCGTTTGGACTtacgagctggaagaattGCTGCCTTCGTGGACAGACCTCCACCGATTTGCCTTCATTGTAGCATGCGAGCACGTGATTTT
TGT