Description :
From Genome Similarity Track
Location :
Scaffold_13:396288- 401764
Transcript NameFunction/comments
Physo_531623cysteine hydrolase
Physo_251998Hypothetical protein
Physo_159208PsAvh252
Physo_290643hypothetical protein
Physo_251991PREDICTED: neuronal pentraxin receptor isoform X2

Sequence
5476 bases(100 bases per row)
ACTTGGTCCAGCTCAGACGTGTGGTTGGAGATGAAGGCGGCGATACGAGCAGCGTCGTCGTTGGCAGTTGCAATGGCGAGCGAGCCTCCAGGGTCGAAGC
TAACGTGCTGGTCGATTACCAGGATTCCCAGACCGCCTTCGTTGATCTTGTTCGCCAAGCAGGCAGACGTGTCCACGTCGTTTTCGTCGTAGGCGCTGCA
GTTGTTGGGCGGAGTGCTGATGTACACAGTGCTGGCAGCGGGAGCTGTCAGCATTGCAATCCATGAGGTGAACAAGGCGAGCTTGGCGCTGATCATCTTG
AGATCGAATTGCTGATTAATTCAGCGGTTTGCGCTGATGCTGGGAGGTTCAGAAGTGAGACTTGAACTGCACAGCGCAACTAGCAAAAGGTCTTTCTAGT
CGCACCATCCGTGACATGCGTTATGCTACAAGGAGGATGCGCATTGCAATGACAACGAGGGCGTGGCAATGACGTCGTGCGCGTGTGCAAAAGATGCCGC
TCAGCCAAAGAGAAGAACATTGATATGTACCAGACACGCCGTGCTTAAACAAACAATTGCGAATCGCAATTGTTTGTTTAAGTGCATCGCAATTTGCGAT
GCACAAGTAATAATGTAAGCTGCATGTATTACAGTACGAAAAAACTTAAGCATTTAAAACTATGAAAATCTTCAAAGAGAAGGTGAAAGATAGTTACCTC
AAACGGGTCTCGAAAGCCATATACAGCAAGTTCCTACGAGTCATAATATTCGTCACGAAAGAGTTGTTCCGATAGTGGTGCAAGCGCACCCAACACGTTC
ACTTGTTCGGACTGGGAACCTGTGCTCTTAAAGTAACATTGAAGCATGAATGACTTTCAAAACAGATCAAAGTAGAAAAAGAAAACTACGCTTGCATTTG
GAAGGCAACAAAAAATACTACCACTACCATGCATACCCATTACGGGTGTTCTAAGCCTCGATGCGGGCGAGACATTCCGAGAAAGAGTCTATGCGTCTCG
TCTTGATGGGCATCCGATCACGACTTACTTGGTTCGTTCCTTCATTCCGAGCGGAGCTTGCGGTTCGCGTTCGCCGTCGCCGTCGCGCTTGCCGTCGCAC
CGCCGTTGGAAGGCTGGGCCGGGTAGCCATTGTTGACCACGGTGGTGGGGGCGCCCACGTTCACGCCGTTGTAGCCGACGACACCGGGGGCGCCAACACC
GACAACTCCAGGCACGCCAACGCTCACACCAGGGCTGACGACACCAGGCCCGTAGGCGCCCGTACCGCCCACTCCGACGGTCGCGACGCCGGGAATGCCA
ACGCCGACGCCCTCCGGTCCAGAGAAGAAGGTCTCGGCCACCTCCTTCTCCGCGCTCACTCCGCTTGAGATGGCGACGGCGGCGACGACGCACACGGTGA
AGATCTTGCTGTTGCTGAACATGGTAGCTGGGGGGCTTGGGTCGGGCGGTTGAGGCTTGGGTAGGTGAATTTGAGAATGAGGGCTACAATGCAGCTTGCC
TGGGGCTTAGCTCGACAACGACAGGCTAGAGTCAAGTGCCCATGCCTGCCTGTTCGCCGCTGAAGGTTGTGGCCTGGTTGGTTGACACCAGAGGGCTGGA
AGATGTGGAGAGGCTTGAACAGTCGTTGAGCTCCATGCACGACGCACATCGTCCATAGCCGACTTCGACGTAGCAGCCAGTTGGTCTGGTAAGACGTCGT
TGTGGTCAACATCCGCTGGCCAACGGACACGGACAACCTCCAGATGTCAGGGAAACGAGTGGCCGGTCAATCTGGAGGTGGAGTTGATAGACGTTTACGG
ACAGCAAAACATAGTCGATTCTTGGAACAGATTCTTCAAAGAGTGCCTGCTATTTTGTGGCTCGGATGCGGCGGCTTCTGCAACGTGGACAAGGTTGTTT
TATCATTGAAGCGCTTCGGAAATTGCAGCAATAGGAAACACAAGAGATGGGAACCACGTCGGGTAGGATTCTACTATAGTCGTCTACGGTGGTCTTGCGG
CAAGACCCATTCAACATGTCCGATGACGACGAACCTGTTAGCTCGTCTGCCACAAGGGACACCGTTTTGAGGCGATTTTCTGTTGTCACCACCAAGCTGT
GTCGCTACTGCGTTCATGTGGAGGTAGTCGCCCACTTTGGCAGTCGCTTTGTCACGACTGCTGCAACGTTGCCGGGCTAGGTCACAGTATTCTTATCCGA
ATCGTTTATATTGCGATTTGTGAAGATACTTTGATACTGAAGTTTGTATGCTACATTAAGAAATCTGTCTGTAGTATGAGATCTAAATTACGGTAATCGT
TATTAATACCAGTACACTATACACTATATAGCGAATCTGTATATAATATATGTATTGTGCTTTGCAAACGTTTTGTCGTTTTGACTTGGAGCTCTCCTCG
ATTTATCATTAAGTCGAGGTCGATTTAATAAAACGAGGTCAAAGAAAGGGACAGATCGATCTATTTAGGCCGGCTAATAACTCGAGCTACGACAATCCAA
ATCAGGGCTCGAGGTCGATCTCCTGGTGGATCTGGGCAGAACGAGGTCGATCTACGGTAAATCGATCCCTTTTGCGTTTTCAAAAGCGCAATTCGAGGTC
GATCTAAGTAAATCGAGCTACCGCCTCTGTTTTGTACACTGATTTGTGGACCGGCCTTCCTCGATCTAGGCCATAATTCGGGGCGACATTTTATCTGCAA
AGCACAATATATATGTATGTATACATGTAGTTGAATGAACTGTGACAAGTGGCTCACGGCCCGTGAAACACTGCGTTTTGCCGTGAGTCACGGGAAACGC
AGTGTTTCCTGTGAACCGACTGGGATCGTACAGGACAGCTCTACAGTTGACAAGCGACTCTATTCAAACAGAGCAGTACTAAGTACGTAGACTTTATTTG
TACTGAATGAGGTAGTTCCCTCAGTTCTCGTGCTCAACAGCCACATACCAAGATCTCGACACCACTATGAGCAAGTGTCTCGTCCTGCTCGTGGTCGCGC
TCTCCCTTCTCGTGAGCGCTAACGCTATCGCGGCCTCGCCCGAGAACATGGCGTCCAAGTTGAGTGCCCTGGGCGTGAACGACAAGCGATCGCTTCGCGG
CATGAAGTCGACTGATGGCCCAGCTGATGAACAAAGGGGCGATTTGACCAAGATCGCCCAAAAGTTCAAGGCGGCGTTGTCCAAGACCAGCATTGGTCAA
AAGATTCAGGCGATGCAACTAAAGAAAATTGCTGCGAGAGAGGAGCAGGTGAAGAAGCTGCTCCAAGAGGACGCCCCCTTCGCGACATTGCACGCCAACA
AGGTGACGCCTGGAGAGTACTTGCAGGCGACGGGAATCAAGTTGTCTGAGCTGCCAGGCGCGAACGCTGAGATACTCGTCCCCGCGTACGGAAAGTTTAA
ACGCTACAAACAGTTTGTCCAGAGGCAAACGCCTCAAAAAGTTATCCGTATCTCCGACCGAGAAGGAAAGCGCTTTAGGGTGAGAGACAATTTAATTTGG
TTCGCATGAACCTAATTCACGCAGAGAGATAGAGAGTCATTTGAGCTATTACAGTGCTATGTGTTCTCATTCAGAGTTGAAATTTGCCGCTGTCGCTTAC
TACTATTAACCCTTTTAATTGTCGACTCGATCCAGTGGAGGATGACAGTATGCCGCGGAAACATGCCCGCCTGGCCCGATGCAGCTAGAGAACAAGTACA
GTATCAAGTATCCCTCGCCTATTTGATCTTTTTCCAGTGTAGCCACTACTACGGAAGGTTGCCACTTCAACTAGCTGTGAGTGAAGACTCTGCCAGCACG
CCAGAGATGCAGCCTACAACTTCTACTTAACCCAAGAGCACTCGTTACTTAGCCCCCTTATCGGCACGGGGACGACCCAAGGCTCGAGAAAATAAACTGT
TACTCAAGGCATCACAGGATTAATTCAGCAACTTTTCCTTTGTGGCGGGAAAGACTAATCCCAACAGGGAGCGGAGTTTATAGTTAACTCAGCGTTTGCG
GCCAGGCTGGACGATCACAACGCTCCTGCCTTCAGCTGGACGCGTGCACCGAACAGCGCGCGTGTTGATGCAGGATCCATGTCGGTCATCAGGGCGCTTG
ATCGTGGCGATGGTTGAGGAGCCGCGGGGTTGTCCACAGCGCGAAAGTTCAGAGATAGTCTCGGCGGGTAGCACCGAACTCCAAACGCGAAATTTGTCAA
TGAGGCCGTAGAACGAGTACCATCCGCCGCGCATGCTCGAGTGCGGCATGTGATCACTTCCAGCGGTATTGAGGCAAAAGCCTGTGCCGGTCTGCTCGTG
TGGGTGTCGCTGCCACATGCTGTTCAACGTGCCGGTCTCGGACGACACAACCTTCCCGTCGAGGTACACTATCTGTCGCTGAAGGGTGTCGCCGTACGTG
AGCGCCAAATGGTACCAGCAGTTCGGCTTCAGGGCTTGAGCGACGACCTTCTTGTCGTCCAGGACGGAGCAGCGTAGGTTCAACTTCATGTCCACCATTA
CAAGGTTACCCGGGTTGCTTCCTGGTACACCGTAGCTAGCAGGATTAGCTTGGAATCCGTAGATGACTCCACCAGCAGGCTGCTTGGCGCTCCCAGGAAA
CAGGCAGAACCTCACGTCAAAACTGAAGCTCGAGTCCTTCTCCAGACGAAGATCAATTCTGCATAAACACTAACTGTATAGCTGACGCTAGTGTTTGCAA
ACTGTTTATTAGTGTATTGTGGATCGGGCTAACGTGTTCGTGGAGTCAGACGATTTCCAATTCTCCATTTTGAAGCTCTCTTTACGCAACGTTCTTCTTC
CCTCATGCAACAATGATATCCTTTACCAGTTCAGATGACTCTGGCGCCTTGGTGCGTGCGTGAAATTTAAATTCCACAAATAACAGTTCACTTGAGTAGC
CACCAACCCGAGCCGTTTGCAACCAGCACTTACATGAAGTTAGTGTGTTGTGAAAACCACAAACATGTATGTGGAGAGTAAAATGGTACTAATGGATTTC
GCACTTTTGGATGCTGACGCCGACGGTGCCGTACAAGTCTGCACAATGCCAGCCATGAAGGCAGCTTTCGCTGCCACCAAGACGGTGATTTGTGTGTTCT
CGGAAAACGAGCGACAACGGTTCATTGAGCAGGCAGCACTGCTACTTTTCACCTCCGAGTCGTCATCCTCGCACTGTACACGATATATATGTCCCATTCA
TTTTTGGTAAGTGTCATGCAGTATTGTACATCAGTGCTCTGATCGTGGATTGACTCCTAGCTTATCACTAGACCTCTACCAATACGGCAACATCAGAAAA
TTTCCCGTTTTCCCCATATACTGAATATGGGAGATATTTGGGGGTTCTTGTAGCAGGAAGGCCGGTTGAAGTGCTTTGTCGGAGCTGTCCACCAGTATTG
ATAGTTTGTCATTTTTGTTTTGTAAGTATCTGCATGTTATAGCAAGCTGCATTTGTTGCTTGCATACTGTACAAAA