Description :
From Genome Similarity Track
Location :
contig_47:396281- 397291
Transcript NameFunction/comments
g9269.t1RAW35948.1 hypothetical protein PC110_g7770 [Phytophthora cactorum

Sequence
1010 bases(100 bases per row)
TGCACGCGCAGCTCACGCGCTTCTCGGCGCTGCCCGATGCCGAGATAGTCGAACTGCTGCGCGTGCTGTCCGAGTTCCTCATCTACTCCGACCAGCACCG
CGTGTCCGTGGATCTGGGGGACCAAGCGGAGGCGGACGACGCCGGCTCCTTCTTCGACTACTTCGGAGAGACTAACATGCTCGCGCTGCTGGTGGAGCTG
GGCGCCAGCCAGCCCAGCGTGCCGGTGCAAGTGCAGCTGCTGCAGACCATGAGTATATTGGTGCAAAATATCGCAACGCGCACGTCGCTGTACTACATTC
TGAGCAACAATCACGTGAACCGCCTGCTGGAGTGTCCTTTTGTAGTGGACAGCGATGACGACGTGCGGGACTGGTACGTCACGTTGCTAAAGGCCCTGTC
GCTCCGGTTGAACGAGGAGACAGTGCAGTTCTTTTTGGACACGCAGCACGGAGACGACTTCAGCTTCCCGCTGTATGCGCGCGCACTGCGGTTCGGCAGA
TGCAACGAGACCATGGTCAAGGTCGCGGTCAAGACGCTGACGCTAAATGTGCTGAAAGTACCGGACACGAGAGTGCGGCGGTTCGTACTGCAGTACGACG
ACCTCAACTACTTTCGGGATATTGTCGAGATCGCGAACGACTTGACGTTGAACTTGCAGGGGCTGCTGAACAATTGGCCGACGTCGGAGGACAAGGTGGA
ACGGACGGCGGGGACGGAGAAGCTTGAGGAAGCAGTGGACGCGTACATTGACCACTGCTTCTACCTACAGGATCTGCTGGATGTGAATGTGCCGGAGCTC
TGCTATAAAATTGGGGACTTGCTCTTTTCACGGCATATCAAGAGTTTGCTGGCTACTAGCATACTACCGGATTGCGGACCGCCGCCACAACGAGTTTCGA
CACAGTTGGCACTTTATTTACTCACAAGACTGTTGGGCATCTTGGAGCATGCACCTCTCGTAAATGCAATAGCCTTCATGTTGTTGTCGCCTGATGCAAC
CGAAGACTGC