Description :
From Genome Similarity Track
Location :
Scaffold_306:3961- 10634
Transcript NameFunction/comments
Hyaar_Emoy2813659callose synthase, putative

Sequence
6673 bases(100 bases per row)
GTCACCATCTACAGCGCACTGCCGGCAGGAGACTCGAACATCTGATAGTTCGAATGAGACTTCGCACGCGAGCGACTGAAGTTTTTGGAGCGCGCGCTAC
CTGGCGTGCGGGCGCTGCGACGAGACGCGCGGATGCGGCGCAGACGTGTGCGCTCGACCTCCATCTCACTCTTTGTGCACACCATGCCGTTCTTGAGAGT
GCCCACAGTAAAGAGAAGCCCCATTGACACTACACAGCAGCCAGTCAATGCGAACAGGTAGTAGTACTCGTCGCCGGCTGTATCATTGGACCGGACGTAA
GTGGCGCAAACGGGCAGCAAGAAAAACACCATAAAGTACACGGTCACGGTTACCGCGCGCTGCTTTGTCGTGAACAGGCCGACGGACGAGACCCACGGCA
CCGAGGTGATTCCCAAACCAGCGAAGAAGTACAGCAGTAGACCCACAATCTGCAGCATCACGTACTCGCTGTCACCGCTCATGGAATCCGACAAACAGTA
TACTCCCAAGACGCAAACCAGGGTTGCGATCGGCAGCAACGTAGAGAACAAAATACGCTTGTGGTCGATGCGGTCCATGAAGAAGAACGAGAAGAGCGCA
CCGAGAAACTGGATCCCCACGCAGTTTACAAACATGTAGGTAGCGTCGTCAATACCACGAAACGCGTCGGACAAGTACATGTTCACACATCCGAGAAACA
CGCTAGATACCAGCATCAAGAACAAGCCCGTCAAGAACTTAAAGAACAAAGTGCCGGGGCTGGCATTCGTGTCATCGCCGCCAGCCTCTTCATCACGAAT
CATGCGTAACTCCTCCGACACGCCCTCCTTACGACGCAACACAGCAAGGCATCGCTCACACGAGTCCAAACCCTCGCGCATGTACACCCAGTACGGACTC
TCTGGGAAGATGTACACCGCCGGCGTCATGATTGAGAGAATCAGAGTGGCAATAAACACTTGCCAAACCCAACCAAGATCTTTTGACGAGGAGGAGAACC
AAGCAGCAAACAAGATGCCAAGAATAAAGCCGCTTCCGAGCAGAAGAAGAGCCTTGCCGCGCATGTCACGAGTTGAAATCTCGTAAATGTACGCAACCAG
CGTAGGTAGAAGCACGCCAACCGAGATACCAAGTAAGCATACACCCGGTATTAGAAATCCTTCGCCGCCAGACTGCACGGCGCTCACGCCAAGCATGCCA
AGTACCGTCAACAAACCGCCGAGAACAATCGACAGACGACGACCAATGAGGTAGTTCATGATGCCAGCGACAAACGTCCCACCCACGCAAGAAAAGTAGA
ACGAATACGTTACCATTCCATGACCAACATAGTCGTCAAGTAGCCTGTATGTCGTAGCGTAGCTCAGGAAACCGGCAGTGCTCTCCAGAGTTGTAAACAA
GTGGAACAACCAGCCACACCCAATCCCGCCAAGCACACCCATGAAGGCAGCAAGAGAGAACGCGTATTGCGACGAGGCTGATACAACTTCAGAGAAACCC
TTGTTGTACATCATTCGCGTCTGAACGATGTTCAAAAATGGGACGGCTGACATCACCAAAAGCGGGAAAATCATAGCCACTGCAAAGATGAAGTCGAAGA
AGAACGCAAGCTGCTGGAATGTGCCTATCGTCGCGATTGACGAGTTGGCGAAACTGTACATGCGCGCCATTTCATTAATGCCGTACAGAGCCGCCATGTA
GCCGAAGAATAGGGAAAGGGTTCGAACGAAGCTGAGTTCGAAGACGACCATAGTAGCGACTAAGAACACGATAAGCGTAAACGCCACCATGAACAGGTAA
GTGACCGCGCGTATCGATGAGTGTACATTGCGGAAACAGTTGCCCGTGAGTCGCGATAGGCCCATTGCCACAACCGTAAGGACAGCAGCGGCAAAAACTA
GAGCCACAGTGACAAACTCCCACTCGAGCGCCACCACGTACCACATGAGCACGAAGTGACGGCATTCACGCAAAATGACAGTCAGACGGGCGATCGGCTT
CGTGTTGTGGTACAACTTGAGCTCGCCCTTCCACCAGCTGATCCACCCACCGACCATGACCGCGTCTTCATCCGTGTAGTCTTCGGAAGCATACATCCAC
TTTGCCCACGCCGACACATCGACCTTTGTCTTCTCCCAATCCAGACCGTCGGTGTTGAAAATGTACGGAGATAGTAACCACACCACGGCGATGACCCAAA
TAGCAAACGTTTGCACACCAAAGCTCTGCGACGTCTCACAATACTCATAAGCGAACGAGTTGGCATCACCAGCAACGGAAGTGTCGCAAATGTTGAACTG
GCCAAATGCAAGGTATATCAGACACAGACCGATAAGCTCCATAGCTTTGCGGTAATGACTCAGAGCGTACGCCTTGTACAACAAAACGAACGTTTCACGC
GTGATCTTAAACCCACGTCCTGTAGCCTTGTACTGGGCCTCACCGTGGAGCAAATTGTTGTCGAAAAAGTGCATGGTCGTTCCAAGCTGGAAGATAAAGA
ATGCCGGACCAGCCGTAAAGACCATCTCCAAAAATTGCACAAGACCGCGCCGCAACCCCATTTCGGCGAAATACACACAAATCAGCGGCAGCGACAAGAA
CAGACCAGCCTGAATGTAATATTGCGTGTTGTACACGGAATCCATGTCGTGGAAAACACGCTCGTCAAAACCATGCGAGTATGCGTTTTCCATAATGACC
GCCGTCGTATTCATGTTGTACACAATCTGCGTCTGCACGCCAGATAACGCAATGTAAACCTTGCAGTACATGTACACGAATGTTGTCACAATCGTCATCC
ATGTCGCATAGTAAAACCCTGTGTGGGAATAGTACATCGAGTTCAAACGGCAGAAATCCATAAACTGGCCCATGCGATGAGCCTCACGAGCTAGTGAAGT
TTCGCCTGCACCATTCGCCAGCTTACCTTCGAACATCGAAATCTGAGACAGAGCCACATCACGACCCTTACCACACTGCATGAACTCCACGTGCGTCACG
ACACCGCCACGCAGAGTCGTGTTGAAACCGGCAAACACATCTTCGGACAGATTGATACCTTTACTGGCCTTCGACACACCCCCGCGCGTGATGGCCAACA
CCTTATCGAACACATCTGGGTGACCGTAGTGCATACGCACATACAGAGGGTCGGCTAGCACACGCTGTGACAGTGTCACAAACACCAGTTCTTGCCACGT
CTTGAACTTTGCAAGTGAACTAGCGTTGCCCGTGAAAATGTGCTCGCGCATACCGATGATCGAAACTGGTTTCTTCGACGGGTGCAAGTCGGCTGTGCAC
AATAGCTGCGGCATCTTCAAGCACTCTTCAAAGTAGTGCTGCTGGTTCATATCGATCGTCTGCACAAACTCACCGCGGGTAAACGGAGTAGCATTGTTTT
GGTTCTCTGGCTTGCCTTCACCCAAGATCGGATCTCCCGGTAGCGAGTAGCGGTACACTTCAACAATGTCATCGGCTTCACTCTTTATCAGCACGGTGTC
GAAAGATTTCTCGCCATCGACGCTCTCCACCGTGTCCACGTAAGCCACACGCAAATTAGGATACTCGCGCAGCAGATAATCAATATCCGCGGCCTGAGTT
TTACCTTCGGCACGGTGCTTGCCGTACACCTGACAGGCACAAACATACGAAAACTTGAGACGAACCATGTCTTGCAACTGACTTTGCTTCTGATCGGCGG
ACTTGCCAGGGCTGGAGCCGATTTCCAACCAGTGCAGAATTTTGATCGCATCTTCATACATCATCATACCCTGCACCGTACGGGCCAGTGTCTGGCCACG
GTACGACGCCCACAAACGAATTTCTTCAGGATGGTTCTTCTGAGCTTCCTCGGCAGAGCTAACATCCACGCGCTCCAAGAAGTTGTCCCATTCCTCCTGA
TGAATCTTGGTCAGGTACTTCAGAATCGTCAAGTTCTTACCGTCTTCCTCGACCTGCTGGAAGATCGGGTGGTTCACAAGAGGGTCATTCAAGTCTTTCA
ACGAAAACAACACCGTCTCGGCGTAGAACGGAGTGACGACCGAAAAACTGCGCATCTCCTTGATGGAACGCAATTGCGGAATATCCATGACAAGTGACTT
CATAAAAAAGCCGAGACGACGCTGAGCCTCCGTGGTACGCGGCATGGCCTCCGAGCGGTCCAGAGACAACAGCAAGCAGGCACGTGTGGCAGCACCCATG
GCCGTATCACTGCAAAACAGGTTCACGAGTCCGCGCGATGCATACATGTATCCATTGGCGCTAGAGCAGAACTTCGAGTTGCTAAACTTGCGCTGCAAAG
CGGGATCGATGCAAAACGACTGCACGCTCTGTAAGAAAACCTCCATCTTGGCAACAAAGTTGCGAATTACACCCATCGAGTGCACACGAGCGTTCGGAAT
GTGCTGCGACTGCAAATCCGGATCCGGCAGGTCCAAAATCTCTTCGAGAAGGTCCACGGCTGCAGTCCGCAGATTCAACACCTCACGAACGTTAAACGAC
TTCAAAAAACCGCCACTCGAAGCAATCTCCTCGACCGAACGAAACCCGTCGATCACATCGGCATCGTCGTTGCCAAACAGAGCGCCAACCACGTACATAC
TAGCCGTGAAAAAAGAACGAATGGCTGAAAGGCAGTCGTTCTCCACGAGCGTCACGCGGAGCTGCGATTCGCCCTTGCCATCCTTCGCAGTCTTAATCAT
CAGCCCCATCGCTTCCGTGAGTTTGCCAGCCGACAGAAACACCGGCTCAAACACTTCCCCAGTGCTTCGAATGTCGTACTGAAGAATCGCAGCTTCCTTA
TCGTCGAGCAAATCACCTTCGCGAAACGAATTCACAATTTCATTCCAGACAACCACGAAACGCAACATCATTTGTGACTCGTACGCTGCTGCCACGACAC
TAGACCGAGTGGCGTCAGCGCTACTGGGGGGCGCATCGCTCGAGCGCGCAAGCACCGTCACGACCTTCTGATCAAACAGCTGGGGTGCCACACGGAAAGC
CTTGGTCATCTCCTTGGCGCCGCGAATCTCACCCGTCTTCATGAGAACGCCCTGGAAACCACCCAGCAGTGCTTGAAAGATTGTGAAATAAATCTGCGGC
GCGTAGTTGAAAATAAACACGACCGGTAGCCACAAGGCAATGATAATGCCGACATTATAGAACGATACGAGTGAATTCTGGTAATTCAGCGACATGGCGT
AAATGCTCAGCGTCGGCAGAATGAGAGGACGAACCAGGATGAAGTACGACGTCACCCCCTGCACAATCCACAACAACAGCCAAAAGATAGTGTACTTGAC
TCGGAACGCAAACGGCGGCGTCATGTCTTGGCCCACGTAGCAACTCGCGCCCTCTCGCACGAATTTAGCAGCAAATGTGCCATTAATGAGCTGCGGCGCG
ATAGCTTGCGTCAAGAGCACGAGCGCGCCCGGCAGTATATACGCGCCACAAAGTGGGTACAGATTGTCCAGCAGCACCGTGTCCCTGTCCTCGTTCAACG
GCACGTAAATCATAATGCCAAACAAGATGGCAAAGCCGCCGTTCCAGACGATCCGACTCGTCAGCGCCGAGCCGTACGAGAACGAGCGCGAACTCGTCGC
CGAACTCTCTTTCGACATCAACAAGTGCCAGCCGTGACACACTTCCATGATGCACTTGAGAAACGCCATGAGGCTCAGACTCAGGGGAATCGACACGATC
GCGAGCTTCAAGTCGCGCGTCGAGTACGGGCTCACGACACTGCCCAGTTCGGCAAACTCCGACCAGCCGCTTCCGCCGCCGTTCGGTGAGATCGTGACCG
CAAACGCGAGGACGGTCAATAAGACGAGGAACATCATGTTGAACTGGAAGATGCGGTAGTAATTCAGGATCATCGTGAAGATACTGCGGTGTTCGTAAAA
CGTCTTGCCGTGGTTCTGCGTGAGCTCTTGCCCCACGCGAGTGACATCGATACTCAAACAATGCGGTTTCCAAAAGTACTCGTTAATGTCGTCGTAATTC
CTAATTTTCACGTGTTCCAGCGGTTTCCCCAACGCATTGCGGCGTTTCATGTTGCTGGCTTCGCGCCAGATGGGACGGATGACCTGGTCCAAGTACCACC
CCTCGGGCTGCTTGTCGCAGCTCTGCGGGTCCGCATTCACGTCCGTCAACATCTGGTGGAAGAGGTAGCACATACACTCGGGCATGTGTCGAATGTTGGC
AGCTTCGCCCCAGATCAGAAAGTACAACATGACGTCCATGTGCAAGTGAGCAGACGGGGTGGCCGTAGGAATGCCATTGCCCGTGTATGTCACGGGTTTC
GTATGGATGAACTTGCACCACGAACGGTAATTCGTAAACAATTTGTCGGCCAAGTGCACCAGATGCTGGTCCACGGGGTCCGTGGCAACGCAGCGCGCTT
TGCCATTGGCTAAAAGTAACAGCACGTGCTCGCGTTGGTTGCTCACCGAACCCTCTTGAAACCCAAATTTGGCCTTTAAAACCTCGCAACAGTAATCAAT
GGCCGTCTCGTCGTCCGACGGCGTGGCCGTGCCCTTGATGCCCGACTGCGTCATGTCCATGGAATTCAGGCGCATGCTCAAGCGTGCAGAGCGCTCCGAC
TTGTTGCGACGACGGTCTGCGTCGAGCTCGAAGTAGTTGGAGCTCGCGCGCCGACGACGGTCCATCTCGGGCG