Description :
From Genome Similarity Track
Location :
Scaffold_1416:3960- 6261
Transcript NameFunction/comments
Phyta_totarag12927hypothetical protein PHYSODRAFT_346539

Sequence
2301 bases(100 bases per row)
aAGTTCTTCATCATAGTTTGCGTTTGCCTTGACGTGCAGAATTTGACCCGGGCCAACAGCGCCTTCAAGCAATTTCACAGCCATAGGGTTGagaacatgc
tgctggatcagACGCTTCAGCGGACGGGCACCGTAGAGCGGGCTGTAGCCGACTTCAGCTAGCCAGCCCTCGGCTTCTGGTTCCACCTTCATCGCTaact
ccttctcctccagcaaccCGTCCACCTGGCGCAGCTGCAAATCCACGATGGAGCAGATGTCCTCACGCTTCAAACGGTTGAACAAcacgagctcgtcgat
cCGGTTGAGGAACTCCGGTGAGTAGTGAGAGCGTACAACGTTCATGACACCAGCTTCGGCCATAGAGCTGGGAGCGCCCTCAGGCAGTCCAGCGAGAATC
TCTGAGCCCAAGTTGCTCGTGAGGATAATAACTGTGTTGCAGAAGTCCACGAGACGACCTTGCGAGTCAGTCAGACGACCCTCGTCGAGCACCTGCAGTA
GAATATTGCTCACATCGTGGTGTGCCTTCTCAAACTCGTCAAAGAGAACAACCTGGTAGGGCCGGCGGCGCACAGCCTCCGTTAGTTGACCGCCTTCCTC
GTAGCCGACATATCCCGCGGGTGCGCCAATCAGACGGCTCACGTTGAACTTCTCCATGTACTCGGACATATCGATGCGAGTTAGCGCTTGTGGGGTCTGG
AACAGGAATTCAGATAAGGACTTGGTCAACTCCGTCTTGCCGACACCAGTAGGACCCAAAAACATGAATACGCCAAGTGGTCGGTTGTGCGCGTGAAGCC
CAGCGCGTGCAAGGCGGACGCAGTTGCTAACGGCCTTCACAGCTTCCTCCTGGCCGATCACGTGCTGGTTGATGTGATCCTCCATCTTGAGCAGTCTCTG
TTTCTCACCCTCCATCAATGTCGACGCCGGGATTCCTGTAGTCTGGGCTACTACCTCAGCCACATGGTCGGCTGTTACTGCGTCTCCAAGTGCGGTTCTG
CTCGTCTTTCCTGTCTTCTTgacctcctcttcctcctcttcctcatgAGCAACTTCTGCCTCCAGCTTTGGAATGACAGAGTGCAGcagttctccagcac
gtgcATAGTTACCGACGTTCTGTGCCGCAACCAAATCACGGCGAGCTTCCTCAAGTTTGCGCTTTGCCCGCTGCATCTCTTCCAGTTTGTGCTTTTCAGC
ATTCCACTCATCCATCAACTCACGCAACTCTTCAGAAGCCTTCTTCACTTCCTCTTCCAAAGCAGCCATGCGTTTCTTCGATGCCGAGTCCGTCTCCTTA
CGCAAAGCCTCAATTTCAATACGACGCAGGATAATCTCGCggtccagcttctcgattGGCTCCGGTTTGCTCTCCTGCTGCAATCGAAGGCGCGACGCCG
CCTCGTCCATCAAATCAATAGCCTTATCAGGCATCTTCCTCTCCGTCAAGTACCTGTTCGCAAGCGTAGCAGCTGCCACCAGAGCACTATCAGCAATTCT
CACGCCGTGATGCACTTCGTACTTCTCCTTCAGTCCACGCAGAATCGTCACCGTGTCCTCCACACTCGGCTCCGAGATGAGCACCGACTGGAACCGTCTC
GCCAGCGCCGCATCCTTCTCAATGTACTTCCTGTATTCGTCCAGCGTCGTGGCTCCCATGCAGTGCAGTGCGCCGCGTGCCAATGCCGGCTTGAGCATAT
TAGCAGCATCGGTAGACCCTTCATTACCTCCCGCCCCCACCAACGTGTGGAGCTCGTCAATGAACAAAATCACCTTCccctcgctctcgtccacgtcctt
cAACACGGCCTTCAGCCGCTCCTCGAACTCTCCTCGGAACTTGGCTCCAGCGACCAGCGCGGCCAAGTCCAGAGCCACCACTTTCTTGTCTTTGAGGCTG
TCGGGCACTTCGCCCAGTGCGATACGTTGCGCCAACCCTTCGGCCACCGCTGTCTTGCCCACTCCTGGCTCTCCAATCAGAATCGGGTTGTTCTTGGTGC
GCCGCGACAATATCTGAGTGGCGCGTCGAATGGAATCTTctcgaccaatcacggggTCCAAATTGCCGCCTTTGGCGATCTCGGTCAGGTCGCGCCCGTA
TTTCTTGAGACTTTCGCCCTGTGGCACGTTGTGCGGGTTGATCCAGGGCGGAGACTGGCCGCCCATGGACGCCAGGCCGCGACACGCGAGGAACAGAgca
ggcgacgacgtgcgcagcagcacacggCTGCCCACTGCGGCGCGAGACAACGCTAACATTGCCGATAGTGTTGGTCTTTGTGACTTGCTTTCTAGTTGGT
A