Description :
From Genome Similarity Track
Location :
Scaffold_1517:396- 4414
Sequence
4018 bases(100 bases per row)
CTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAGCGCACCCCAGATCTACCAACGTCTAAT
CGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCA
GGGAATCCTGAAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACAT
CCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAA
GGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATGTGTCCTTCCCCCAGTCGTTACGGGCGATGCAATCCGTCTTGGGCAGTTTGAAC
TACTACAGTCGGTTCATCGAGGATTACGACCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGA
TCAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGGTCCAAGTGGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACC
CCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTG
GAACTGAGGAACAGGATCACGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAG
CAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGA
GATACTCGCGGTCCTGCGCGTGTTGGATCTGAATTACAGCCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTC
AAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGTACACTGGAGATTGTGAGATGTTCGAAAGGGGAAGACGAGATCC
TGGGAGTCTTGGCCACGAGCATTACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGACCCAGATCCC
GATCCCGACGGTACAGGTGGATAAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGACATACAGACGCGGAGGGCATACAG
CACAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCAGAGTATAACGGGCTACTG
CTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCA
AGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCAAGATTGGAATGCCAG
TGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATTAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGAC
GAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGAAAA
CATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTTTCTGATGGGGGATGTACGAGA
CCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTC
AACGAGGATCGGGATGGATTGATGAGACTAGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGG
GTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGAC
AGGCAAGGGCAGGCCCACAATCGAAGGAGAGTCACCTGGGAATATCCAAGCGACTAACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCC
AAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTG
CTGAATCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAGATGATTTGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATT
CAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACAGGAGCACTC
AAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATA
CCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATTCAAGGCGATG
GCGATACCAAGTCCAGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGAC
GCCCGTCCGCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGATACGCCCGCAAATTGGCCCATCTATGGCATGGAC
CGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAA
GTTGGTCAAAGAATACCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGG
AATATGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAATACGGACGAATTTACCGCGAATTTCTAGT
GTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAAATCTGAACTGTGGAGCATTACTCTATGATTTATTGCGGGATCGTACGAATCGTAAC
AGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATCCGCTGATGTGAGTTGGTCATATCGATGGGAGGATGAAGAAGGACCCACAGGAAG
GGTGTGGGCCAGGAGGAGGAGGATCACTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAG
TGAATGTTTATGCATAAGAGTGACGTTTTACGTGCGAAGAGTCCCGCTTGATCTCAAGCGCGAGCTTTCAAGGGCCCGAACTATACTGACCCAATTGAAA
CTGGGTCATTGGCGCTAGACCAGGATGAAATTCAGGCGCGGATCCAACCGGATCCGGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCG
CCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAGGGGTGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGCT
CTCACTAGATTTCGCAAC