Description :
From Genome Similarity Track
Location :
contig_45:395965- 396975
Transcript NameFunction/comments
g8129.t1hypothetical protein

Sequence
1010 bases(100 bases per row)
GGAGCTTGGACACTGGCAGCTGGTACTACAACGGCAAGGCGTACCAGAAGTACGCGTCATTGTGTTTGATGGCCGCCGACAGCTCAGTGGTGGGAGATGA
CACTACACTCCTGAGTAGTTGTTTGTCGAAGCTGGAGACACTCATCGAACCTTTTGTCAGCAACACGCTGAGCGTCCCATTGGTGTACGAGACAACGTAC
AAGGGCATTGTGACAAGCCAGGTTTTCACTAACAATGATGTCAACGTAGAGTTTGGTAACGGAGTGTACAACGACCATCACTACCACTACGGCTACTGGA
TCACAGCGTCGGCCATCCTGAAAAAGCTGGATCCGACATGGTCAGGCATGGCTCAACTCGAGACGATGGTGTGGACGCTGCTCCGCGATGTGGCCAACCC
GAGCTCGGAGGACACACACTTCCCCAAGTTCCGCCACTTCTCCTGGTTTCTGGGTCACTCCTACTCGCACGGCGTGACCCCCATGGCTGATGGTAAGGAT
GAAGAGAGCACGTCGGAGGATGTGAACTTCTACTACGGTATGATGCTGTGGGGCAGGCGGCGGGGAACAAGGCGGTGGAGGACCTGGGGAGCCTCATGCT
GCGCCTCAACGCGCGTACAGTGCGCACCTACTTCCTCATGACGTCGGACAACACGATTCACCCGCCTCAGTTCGTGCCCAACCACGTCACGGGCATCTTC
TTCGACAATAAGGCGGACTACGCGACGTGGTTCAGTGCCGAGAAGCACTGTATCCACGGCATCCAGATGATCCCTGTGTCACCGATCAACGGTCTGGTGC
GCACGACTGCATTCATTCAGGAGGAATGGGATGACATCCTGTCGAAGGAGGCGATTGTCACGGGTGACAACACTAGCAATGCGTGGTTGTCACTCCTCCT
TGTTAACGAAGCGGCGATTAATCAGGCAGATGCGCTGTCAAGGCTCACGACAGCGACCATGGACGACGGTCTCACCCGTTCGTGGGCCTTGTACAATGCC
GCGTCTCAGC