Description :
From Genome Similarity Track
Location :
contig_100:39592- 40654
Transcript NameFunction/comments
g13490.t1hypothetical protein

Sequence
1062 bases(100 bases per row)
CTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAGATTTCAAGGAGGAGCTCAAACTAGCGTT
TGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTG
GTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAG
AGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCC
ACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGAACCTCTCGAGTGCGACCGCTGCTGGTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTT
GCTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCA
ATAAAAAAACTAGAGGGACCAGCAGGGCGCCCCGCGCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCA
GCGATAGTCAATCTCACTGCAAGAAGCAAGATGACAAGACGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAAGGAGAAGTCTCTTCGTGCTCTAGTGGA
CTGTGGAGCGCCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGATGAAGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCA
ACAGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTATGCGTACGCTTCTCATATCAAGAGAAGGAGTTCGTTGACGAGCTTATCGTCCTGGAACTGGACG
ATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGG