Description :
From Genome Similarity Track
Location :
contig_137:39590- 42492
Transcript NameFunction/comments
g13700.t1hypothetical protein
g13701.t1XP_009522363.1 hypothetical protein PHYSODRAFT_488937 [Phytophthora sojae

Sequence
2902 bases(100 bases per row)
ACGTCCTCACGATCCTGCTTGTCCAGAGACAATGTCTTCGTCGTATGATAGGATGCAGCCACAGAATCGGAAGTCGGATGTGAATGCGTATGATTCTGTA
GCGCAAGAAGAGCAACTGGCAGTTAGCACGATACAACATCAACGTATAATGACCAATGCGTACCTCGTTTCTGATCACTATCTCGTATTCGTTGGTTTCC
GTCTGCACGATAGTTGGCGTCAATCGTGCCTTGCACCCGCAATACCGCGACTTTCGATTTCGATAGCCTTTTGATCGGGACCCCTGTTTAACTCCGTGCG
TGCAGCGAAATATTCTGTAGCTCCATTCATATCGAGAAGGCAGTTGATCTTCGTCATGCGTGCTGTGCATCCACAAAAATAGCAAGTGTTAGTTCAAGCC
CGCCAATTCACTCACATAAAAATAAACTTACTGATTGTGCATCTGGGTTTTCATCGAGCTCCGGACGCGAAACTTGAGTTTATTCTTTCTTTTGTACTCC
TCGAACACATTGTCAAATTGCTCCCACATGTTGATGACTACAGACGGGAATGGTGGTACCACATTTGCAATGTCGTCACGAGCTGCATCGAGCGCAGCGA
TTTCATCGTCGTGCTGACTTGCACGCTTCCGAGGAGTGTATTCAGGGCGCAGCTGCTCCCCAACTTCGTCGCCACCCTGCAGTTGTTCGGATTTGTCGTC
GCCGTCGCTTCCGTCAGCAGGTTTGGGTTCAAAGCGTCGACCCTCCGCGGAATCCTTCATCACGTATGGCTCTCCGCCCTCATTAGCGTCAAAACAATCA
ACCGCTGATTTCGCCTGCTGCTTCTTCGCCAGGGGAGAAGCGACGCTTCTTCGTTGGCATCCTGGATGCTGCTAATTATCAGCATGCAATGGGTTAGTTA
GTAAATCAACCATACCTTAAAGCAACCATGACCTTAAAGCAACCTTAATACCTGACATGGCTCCGCGACGGCTGCTGCCGACCTTCCGACCTTTAGATCT
GCGAGCCTTCCCTGCTACATGCACGCCACCAAAACATAACGCGTCGTCATCAGCAACTGATAGCCATACAACCGGTCGATATCGCCCACATACCTGGTGT
TCGTTCAGCGTCGCCCTCGTCAAAAGAAAACAGCTCGTCCTCTTCTGACTCATCGTCTTCTTCCATTATGTAGTCGTCGTCGCTGCTGTCATCCTTCTCG
ATGCCAAGCGTGGCGTACATGTAGTTCAGCGTCATCTTCTTAGGTTTCTTGCGCAGACGCTGCCCTTCAACAGACACAAACGTACACCCACAAAACATTC
AGTGATATGCGTGCACCTCTACATGCCAGCAGCGTTACCCTTACCGTGTGGGTCCTCCCCCTTTGCTGGCACCATGTGTCGTCTTGTGTAGCGCGGTATT
TGCGCTTCGTCCGGTGCTCCGCGTTCTGTACGTCTCGAGATCCTCACTGCCGCGCAAATTCTAGAATGGACGGCTCTGAGAGCTCCAATTTCGTACTTAG
GGAATCGCACTTAATGCTTTATTTCAGCAATTGAATTTTGGGATTATATATTACGGCAGAATTTTTGAAATTCGTCTAAAGCGACTTTACACTGCCAAAA
GCGACCCTACATGTCTCACCATTAAGGTCGCGGTAACCACTCCGGAAAATCCTGCGGGAATCGGCCCAATACCGGTACACGTAGCAGTAGATTCAAGGGT
GATGGCTAATATGTAGGTAGTACTAAACCAAATTACTTTATTGAAATAGTAGTACAGATAGTATAATGTTATTACTACTGACAATGTGTCTTTCCAGCCG
AATTAACCTACCAGCGCTGAAACGGTGCCGTGGTAGAGGCACCACCAACGCAAGAGCGGCTCTTGATACCCGCTGTGTTGACACGATATATACGTCAGGA
GCCCCAACCGGGGGGGGGGGGGGGGGCAGTCTGTAATAGTCTGGATCAAGAAATGTCGCTCGCTTTTCTTGAGAACCGAAGTTGAAGTCTGCAATTATTC
CCGTTGAAGCCGAAAGATGAATACATGCATGCATCCTCTTCCTCCTCAGCGATTCCTCACACATTCGTGTGTGGGGTCGCACGGACCACCTGGCAAGTCC
TTTGCATTCCCACCTCGTCATCAGCAGGTGGCAGCTTTTTTTTCATCTTGCCACATCAGCTGCTCGACTATTAATACACGAATGCCTCCAGGACTGCCCT
CTACTGTAGAGTCTACACCACCGGGTAAGACAATAGCTTGAGTTCAAATCGCGAAGCGTCTCCCGTCCACAAACTCGCGCACGAGGTGATCCCTGGCACA
ATTGACGCAATGCGAGAACCTCATCATACGTGTAAACTGTACAGATACATGTATTTACATGTACTGTAGCCCACTGCCTAAAAGCTTCTTTGTGTCGGTG
CAATCGAACGAGCGTGAGCAAAATCGCCATGCAAAGTCTGGCAGTTCGACGTAAATGAGCGACCACCTATGGCTCTCGGCAATCGGTTCGGCCAATTACA
TGTACGTGGCGCCTCTGCCGGCTGCCGTCTTGTCGAAACCCGCCTTCCATGATATCCCACTCCCGCCATCACATATCCGACTCCCTCCACTATCCAATCA
CCTTCAGTTATCTATTTTCCACACAACCCGACTCATCCCTATAAAGAGGATCCACTATCACAGTTGGCATCCAAGCTGACTTGTTCTGACTCTTCTCTAT
TCCAACAGAAGCTGCACTTTCCGATCCATTCAGCCGAGCAGCTCCATTCCTCGGTACGCTACGCTTCACTTGCGCTCTGACCGCCTTAGGGACATGGCGC
TCTCGGCGGTGGACGATGAGCAGCAGGCTCGGCTCTGTGGGCGCGCGCGCCAAGGAGGTCTTCCAGCCCATGCGCTGGAAACGCATCGGGGCGTTGGCCG
AC