Description :
From Genome Similarity Track
Location :
Scaffold_1254:3959- 5129
Transcript NameFunction/comments
Phyta_totarag12530hypothetical protein

Sequence
1170 bases(100 bases per row)
AGATCAACTAGCAGCACTGCCTGAGCTGAGAGATATCAGCCTTGAGGCTGGCCTCGCAAAGGCTGAAGTTGGAGAACCTGGAGTCACCACCCCTGAGATG
AATGCCCAAGTATAGGGAATCCTGGAACGGCATCATTCCAGTTTTCTTGGCGATGGTAATGCAGTCCCAGCCCCAGCTAGAGGTGTCGTCTGTGACTTGG
ATGTCGGAGATACTAAACCTGTCGCTCAGCGATCTAGACAGGTCCCCCACATCAACTTAGAAAGTGTACGACCTGCTCAAGAAACTGTTGGAAACTGGAC
TCGTGGAATACTCGAACTCAGATTGGGCATCACCGATCGTCAttgtgatgaagaagaactgtGTTGACATCCGACTCTGTATCGATTACCGACTGGTGAA
TCAGCTGGTCAAGCTCATGCGCTATCCTCTACCTTTGATTGACGATTTGTTGATTGGGCTTGAGAGTGCAATGTGGTTACTGAGTTTGGATATGACTAGT
GGTTTTTGGGCAGTGTCGATGACGCTCCGAGCGAAACACATCTCAGCTTTCATTTGTCCGCCCGGTCATTTTCAGTGGACGCGTATGCCGTTTGGTCTGA
AGAATGCACCCCTGATCTACCAGCAGATACTCGACAACTGTCTCTGGGGATTCATGCGACTTTCGCCCAACGAGGAAGCTCAAGTGGACGCTGAAGTGCT
GGATTTCTTGGGAATTGAGGCAGATACCTCAACTGACAGCGACAAAATGCCAGTGCTGTCTGAGGAGCTAACTGTTTTCCGAAGAAATATCCCAGCCCCA
CCTCAGCTGAATCCAGTCCTGGGAAGAAGTTCCTACATCAATGATATCGCGTCTGGAGCTGAGACCTGGGGACATATGTGCATTGACCGAAATCGTTTGT
TGTACCGACTACGCTACTGGGGCATTACGGTAAGCATACCCAAGAGCGAAttcggcaagaagacaaTTTCGTATTTATTTCATGAGATTGGAGCGGAAGG
GATCCGAGCTAAGCCGAAGATCGCGAAAGGTGTGCGGAACCTACCGTTCCCGTCAACTCTGAAAGGTGTGCAGTCATTCCTGGGAAGTCTGAACTATtac
aacaagttcatcgaaGATCTTCCAGTCGTGGCTTCAGTGCTGTACGAGTTGACCGACGAACAGATTCGTG