Description :
From Genome Similarity Track
Location :
Scaffold_2194:3959- 5084
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2194-snap-gene-0.2Serine protease family S10

Sequence
1125 bases(100 bases per row)
GAGAACGGGCCGTGCCACGTCCAACCGGACCTGTCGACCACGGCCAACGCGTACTCGTGGACGAACGAGGCGAACGTGATCTGGCTCGACCAGCCGACCA
ACGTGGGCTTCTCGTACGGACTCAACGAAGACCTGGACCACGACGAGGACGACGTCCAGGAGAACATCTACTGGTTCCTCCAGGGCTTCCTCGAGAAGCA
CCCGGAGCTTCACGAGCGACCGCTGTACCTCACGGGCGAGAGCTACGCAGGCCACTACGTCCCGGCGGCCGCGCACTACATCTGGCAAGAGAACGAGGCC
TCTGTGAACACGACCAATGCGACCACCGCCGCTATGCACCTCAACCTGCAGGGCATTGCGATCGGCAATCCGCTCGTAAACCCCGTGATCCAGAGCCAGC
ACGCGCTCGACATGGTCGACAATGCGTACAACGTGACGCTCATGAACGCGTCGACGCTCGCGGCCGCGAAGGCTTCGCTGCCGGAATGCACCAAGCTGCT
TGAAGACTGCCAGGACGCAGCTGAGAAATGCGTCGAGGCGCTCATGTTCTGCCAGGAGAAGATCCTCTCGGCGCTAGCGATGTCGCAGCGTAACCAGTAC
GACATCCGCATGAAGTGCGACGCAGCCGACTCGATGGAGTGCTACGCCGACGCCATGGCGAATGCAACCGCGTTTCTCAACTTGCCGGCCGTGCGCAAGC
ACTTGAACGTGAGCGACGAGCACGCCAAAAAATGGGAGGCCTGCTCTGCATCCGTGGGCATGGGCTTCGCCATGGACATCATGCACGGCTACGAGAGCTA
CGTGGCCGACCTGCTCGACGCCGCCAAGATCCGCGTGCTCGTCTACGCCGGCGACGCGGACCTCGTATGCAACTGGTACGGCAACCAGGCGTGGACCAAG
GCGCTCGAGTGGAACCACCAGCGTGAGTTCAACGCAGCGAAAGAGCACGCCTACCTGGTAAAGGATGAGAAGGCAGCTGCTGCTGTTCACGCAGGCACGG
TGCGCGCGTTCGAGACGCAGTTCACGTTCGTCCGCATCTTCAACTCGGGCCACATGGTGCCCTACGACCAGCCAGTGGTCGCGCTCGACCTCATCAACCG
CTTCCTGCGCAACGACGCGTTCTAG