Description :
From Genome Similarity Track
Location :
Scaffold_2:39587- 45073
Sequence
5486 bases(100 bases per row)
TACAGCGGTGGTCAAGCAGTTGACACTCCCACCGGCTACGACGGCGATCGAGCAGGGGCTCTCGCCAGTCGATGGTGCGGTCGAGCATCGAGAGCTCCCG
CGCACTACCGACACGGTTGATGGTGCCCTTTCGTGTCTAGACGGGGGGTGATCCCTCGTCCAGCGATAGCGAGTCTTCAGGCTCGAGCAGCGGTTCGAGA
CACCACAAGAAAAAATCCAAGCGACGCCGTTTTAACCGACGTGGTCAGCCCACCGCCGATATCGCAGTGAATAAGTCCATACACGTCCTGGAACACGTGA
AAGGAGGCGCCGTTTGCTCACGCACATTAGACATTGAGAGCCCACCTCGCGAAGCTTCTTCCATCACACACCTTCCGGGTCTTTCTTGGAAGCATTTTCT
GCGCGATCTGCAGTCAGGAGACATCGAGCAGGTCTGCTTGATAACCGAGTCTGCCTAGGCGGAAGCGATCCACACGGTCGCTACCGACAATCTTCCACTT
CGTACAAAGAACGCTGAGCCGAAGCGGCTCAGTCGGCGCACGAAGAGCGCTTCGCTGCCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATCCAGTATA
CGTCACCGTCCGCGAGCTCGCGGATGTTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGACATTCGCCATGAGATTGATCTCACGCCGGGT
TCCAAGTACTGTGTGACGCGACAGTGGCCTCTTCCACGCGATCAGGTTAAAGCTATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCACGTGCGCG
ATTGTACTTCGCCACACACGAGTCCGATGTTCTGCGTGAAGAAGGCCACGGGTGGTAGTCGCATTGTTCACGCTTTTAACAAGCTAATGGGCGCCACCAT
CCCAGCACAAACTCCGAGGTCTCGGAAGGATATGGTACTTGACACCATGGGCCGCACTGTTATTTTCAGCGCCATCGACCTGACCGATGGCTTCTATCAG
ATCTTGATGCGACTCAGCGACATCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTGGGAGTGGCTTGTCATACCGCAGGGCCTGAAAAACGCAC
CAGCCACGTTCAATCGCATATTTCCCACGGTCTGTGCCCACTTCGCTACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCTCAGCCGCGCTGAGGGC
GATCTCAGCGCCACAGAAATTCACTTGAATCACTTACGACAAGTGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTGCATCTTCT
GTGCCCCGGAGAATCCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCCACGCCGCA
GAATCAGACTGAATTGCGTCAGTGGCTTGGCCTCGCAAATTATCTTCACAAGTACACAAAAAATTACGCTGGTCTGATCCAGCCATTGTCTTCATTGCTG
AAGAAAGACATCACGTGGTCGAGGACTCCCGAACATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGACCCCAATCCTGGCGCTTCCAGATG
GCTCAAAGCCATTCTACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCTCTAATGCAGTTCGACGACGAAGGTCGCGAACGCGTCGTGAGTTA
CCAATCCAGACTGATGAAGCCCGCTGAGAAAAATTATCCGGTCCACGACAAGGAACTCCTTGCGATGCGCTACACACTGATCAAATTCAGAGTGTACTTA
CTCGGTGAGCAGACATTCGCGATCTACACAGATCACACGTCGCTGCGAACAGCGACAAGGAGCCCTCATATCTCTCAGCGCATGGCACGATGGCTGTCAT
TCTTCTCCGAGTACAACTTCGTCGTTCACTACAAGCCAGGCAAGAATAATATTTTTGTGGATGTTCTATCTCGGCGCCCCGATTACGATCCACGCCAAGA
TTTGGGTCGTCAGTCACTTGAAGACGGGGACGACGACGAATTGGATTGCGCCACATGTGTGGCTGCAGGTGTGAACCTGATGACGGCGGTATCTATAATA
CTTCCCCTACGGGAAGAGATCTCTGCCGCGTATCGAGATGACTCGATATATGCCGGTACCCTGGAAAACCTTCGCACACCAATTGATGTCACACTAAAGA
CACTGAGCCGCTCCACGCGCAACCAGATGCACAGATACCAACCTGACGGTGATCTGCTGATGTACAGTATCGATCGATTCGATGCTCCTCGCGTCGTTGT
CCCCAACGACCCCGATCTACGCGCAAGAATTATACACGAATTCCATGACGCTCCAGTGGTTGGCCACTTGGGCCGTGAGAAGACTTTCGCGGCGTTATCC
CTCGACTTCTACTGGCCTCACCTATACAAGTGGGTGCGCAAGTGGGTCCGCTCCTGCGAAACTTGTCAACGCGTTAAACCGTCACCGTCATCGCAAGGTC
CGCAGCGTTCTCTCCCTCTGGCGACAGAGGCGTGGCGCTCTGTGTCAATGGACTTCATATTCGGTCTCCCACCCGATACTGACGGTCGTACTGGTGTTCC
GGTCTTCGTGGATCGCTTTAGCAAGATGTGCCATCTCGTTCCGGTTCCGGACTCAATCACCGCGGCCGATACCGCGGTGCACTTTGTCGACGCTGTCTTC
CAACATCAAGGCCTTCCTGAATCAATCGTCTCTGACCGCGATCCCCGATTCACATCGGCGTTCTGGACGAAACCCTTCGACCTCCTGAGCACCAAGCTCC
TCATGTCGACGGCGGCGCACCCGGAGACTGACGGGCAAACGGAACGCGTCAAACCGCGTGCTAGAAGATGTTCTGCGCCCGTTACGCCCCGTCCTTCGAG
AACTGAAGTTCCTTCCTGCCTCTTGCGGAGTTTGCACTCAACAATGCCGAACATGCGTCGACGGGATTGACTCCGTTCTTCGTCAACAACGCGCGTCATC
CACGTGTCCCCGCACAACTTGCTGTGGGCCAGCCCACGGCGACTGATAGTTTCACTGTGGAGGGGTAGGAATGTGATAACCCTACCCAACCGGTTCCGAT
ACTGGTTCAACCACCGGTTTCCGGTGAGACAACGGTTCTGCCGTCTACGAGTTCAGCTACTCCTGCAGTAGACATCAACGCGGTGACGCATTTACAGTCG
AAAAAGATCCTCGCACCCGCGCAATCCACGTCGTCGCCGTTAGCTGACTGGACACACCGAACGCTGATCGCTCCAGCACAGCCACACTCGACTGTGGCTA
ACTACGCGCCGAAACCTCCAGCGCAACCCGCTGCCAAGGCAGCGGTATCCGACTTTGTCCTTCATCGCCAATCGGTTACCCGATTCGTCCGTGAAGCGCT
ACAACTCGCGGTTGACAAGCAGAAGGAAAACGCTGATAAACGTGGCCGCAAGAACACAAGTTCATACAAGATAGGTGAGCGTGTATTACTCTCAACGGAC
GGAATTCGTACCTCTACTATTACGAACCTAGGCGCGAGCAAACTCGCGTCGCGCTACATTGGGCCATTCAAAGTACTACGATTTATGGGTGATGCCTACA
CGCTAGACATTCCTACGTCGCTACGACTACACCCGACGTTCTACGTCGGGCGACTTAATAAATATCTTCCCGCGATGATCTCGGAGGCGGAGCAGGAGCA
TGCGTTGAGCGGCCCTCGCGATGAGCCTGTCGAGCCAGCGTCCCATCTGTCCCAGTTCCCCGCTCGCGCGGAAAACCTCACCCCTCGGTCCACCAAACAC
CTGCGCTCCAGACTACGCAATCGCTGCAAGCGTTCACGATCCGACTGCCGCAGACTACTCGCCGTCGGCTCGGCGTTCCGAGAGCTCTCAGCCGCCCGCT
CGGCCTCCTCCTGTGCGTCCCGAGAAGTCTTCAGCGCCTGCTCAACGTCGTCCTGGTCAACCAGGTCGCGTCGAATTCCACCGCGACGGTCCTCCGCCCG
TCGTTGACACGAAAGGAGATACGTGCTGGATCTTAGACAGTATTATTGATCACGAAGATCCTCCCTGCGCGCGTCACTCGACCAAGTCGTCGGCTCAACA
CGCGGCTCCCGCCGAGCGGAAGTATAAGGTACGATGGCTCGGGTTTCAACCTGCTGATGATACCTGGGAGCCTCGCGCCAACTTGCTTCGTGACGTTCCT
GATGTCGTCCACGACTACGACTTCAGCCTTGAGTCAAACGTGGCCGCGAGCGACCTCAGCGGCGATCGAGAACGCGATCGACAACGCGCCCGACGAGACG
TCGAATGCGCCGAAGACGGGTCCGTCGCGAACGCCGTCGGCGCGAGCGGCCGCGAATAGCCGCCTGGGTGAACTCGGAGAGTGAGCGCTTATACTTCTCG
ATCCAAGCGTGTTCGGTCGGCATGAGCGGATACTCGACAATATGCTGATCCCACTCAGCTTGCGTCGGGCGTCGCCCGATGTCACACGAGCTGCAACCTT
CGCGTACGCTGACATAGCACAAACGGTCTTCGGTCCAAGCGTCGTTGCAGACTATCAGGCGCAGATCACCGAGTGAATGGTTGGCTTGTAGGGCTTCGCG
ATCACTGAGCCAGCCGACGACACTTTCTCCAGCCTCTTGCATCCGATTCCACCGCCGGATGAATGCGCACCATGATCTCTGCAAAGCTTCGTACGACGCG
CCGTCGAGTGTTTTGTTCTGGAGACGCCTGAAGCGCCGAAAGTGGTCCTACATGGTGTCCAGCGCGTCCGGGGTCACCGCCCCGAACAAGGCGTACAGCG
CCCACGGCTTCATATCCTCGTTCATTACGCTCGGCCGAACTCCAAGTCGACTCACGCTCTCAGGTGCGATATCAGCGGTCCACCCACTGTTCAGCGTCGT
CGCTGACGCTGGAGCCGTCCGCGTTGTTCCGCTTCCTGTCTGGTTCGCCGCCCCCGTCTGCTGTGCCATATTGTTCTCGTCCGCGCAAGTTGTATTGTGC
TGCTCCTGGGTTTCGCAGGAGCTCCCGCCCCTCAAGTTCTCAAGCGTTCTCTTCTCCGCCATTTCCCAGTTTTTCCCGATTGTTCTCCGAAGTGCACCCA
CGTTGGGTGCTTGCTGTCATAAGAGGGGGGTGATGTAATGGGCCCTCCCAAGTTACATATGTAGGTAGTGCTATAGGTTCTTTGTAGTGGTTCACACCAT
TACATAAGTAGGTAGACTTGCATTACAAAAGTAGGTGCAGCAGCACATGAGTAGCGTGTGCTGAACTGCCGTCACCATATTCGTTGAAATATGGGGAGCC
AGACCCATAATCAACCAATAAGGAGTTGACGTGTATTTGAATGGTCAGGGCAAGCCGCCCTGGACCTAAATAAAAACAGAGTTGATTTTCCTTCAGACTA
AGTACTTGGTTTCAGTTTCACTGGACTTGTAAGCTTCCTCATCACTAAGTGTAAGCAAGTAACTGACACCCCAGGCCCGTTACAGC