Description :
From Genome Similarity Track
Location :
Scaffold_62:39585- 43727
Sequence
4142 bases(100 bases per row)
CCCTGCGAGTGCTAAGCCGAACCACTCTCCATCACCGGCCATACAGTCATCCGAACGTCGTACCAGCAAGCTCAACGAGCGCTAAATACATGACGGAACA
AAGAATTGAAAAAGCTAAATTCCCAAACCGGGACATGAACCCGGGTCGCGTGGGTGAAAGCCACATATCCTAGCCGCCTAGATGATTTGGGAGCACCTTC
TATTAACCAAAACAAACGCCAAACAAAAGGCCAAACAAATGCATACTCACACACAACCAAGCGCACCACATCAAGGCCACGCGCACCACATCAAGGCCAC
GCGCATTGCCGCCTTCAACTTTGCATTTAGCACCTTCAAAGACCTTTACCACGCAGGAGCTGTTGTTTTAAACCTGAATCAGACACTGCCGTTCTCGCCA
CGCTTACCCACCGGCTGGTCGTTGACCCTGCGAGTGCTAAGCCGAACTACTCTCCATCACCGGCCATACAGTCATCCGAACGTCGTACAACGAGCGCTAT
ATACATGGCGGAACGAAGAATTGAAAAAGCAAAGCAAAATTCCCAAACCGGGACTCGAACCCGGGTCGCGTGGGTAACAGCCACGTATCCTAACCGCCTA
GACTATTTGGGAGCACCTTCTATTAACCAAAACAAACGACAAACAAAAGGCCAAACAAATGGGTACTCACACACAACCAAGCGCACCACATCAAGGCCAC
GCGCATTGCCGCCTTCAACATTGCATCCAGCACCTTCAAAGACCTTTACCACGCAGGAGCTGTTGTTTTAAACCTGAATTAGATACCGCCGTTCTCGCCA
CGCTTACCCACCGGCTGGTCGTTGCCCCTGCGAGTGCTAAGCCGAGCTACTCTCCATCACCGGCCATACAGTCATCCGAACGTCGTACCAGCAAGCTCAA
CGAGCGCTAAATACATGACGGAACAAAGAATTGAAAAAGCAAAATTCCCAAACCGGGACTAGAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTAGCC
GCCTAGATGATTTGGGAGCACCTTCTATTAACCAAAACAAACGCCAAACAAAAGGCCAAACAAATGCATACTCACACACAACCAAGCGCACCACATCAAG
GCCACGCGCACCACATCAAGGCCACGCGCATTGCCGCGTTCAACATTGCATCCAGCACCTTCAAAGACCTTTACCACGCAGGAGCTGTTGTTTTAAACCT
GAATTAGACACCGCCGTTCTCGCCACGCTTACCCACCGGCTGGTCGTTGACCCTGCGAGTGCTAAGCCGAACCACTCTCCATCACCGGCAATACTGCCAT
CCGAACGTCGTACTAGCAAGCACAACGAGCGCTAAATACATGACGGAACAAAGAATTGAAAAAGCAAAATTCTCAAACCGGGACTAGAACCCGGGTCGCG
TGGGTGAAAGCCACGTATCCTAGCCGCCTAGATGATTTGGGAGCACCTTCTATTAACCAAAACAAACGCCAAACAAAAGGCCAAACAAATGCATACTCAC
ACACAACCAAGCGCACCACATCAAGGCCACGCGCACCACATCAAGGCCACGCGCATTGCCGCGTTCAACATTGCATCCAGCACCTTCAAAGACCTTTACC
ACGCAGGAACGGTTGTTTCAAACCCGAATCAGACACTGCCGTTCTCGCCACGCGTACCCACCGGTTGGTCGTTGCCTTTGCGTGTGCTAAGGCTGACTAC
TCTCCATCACCGGCCATGGAGCATTGCTCCTCCTTGGAGCAAAAGCGACCTCCTATAGCCCCATTGTAGTTATCAGAGAACTGTGGTTTCTGAACCAATC
CGAGGTTATGGAGCTAATCGAGGGTTAAGAAGTATTGCAAAACAACTAACTTTGTGGAGCTAGAGCGACCCCTAAAAACTCCAATGGAGGTCAGCATTGG
AGCATCTCAAAAATGTCCACACGGTAATCTATTTCTGGCTAATGCGAAATTTTGGTTAGACATTCCTTACTTTAACCCCAGCGACTACAGCTCTCTATTA
ATTAGTATTGGAGCATCTAAAAATATTCACACGGAGATCTAATTCTGGCTTGATTTTTATATATTCCTTGCTCCAACTCCAGGAACTACAGCTCTCTACT
GTAGTAGAACGGAAGGGCTGATTCAGCAAGGCAGGATATGCATCACTTCAGGAAATCCCAACCTTCACAGCGTTAATCTACCTAATGGGTAGGGAATCGT
TAGCATTGAAAACGAATAAAACGAAGATAACTTTCAGAGCTTCTTCGGGCGAAGCACGACTTTGTAGTGTAGATAGCGGAAATTTGCAGGATAGACTGAG
TGATCAGTGATCAAGCCGCCTTGCATTTTGCTTACAATCCATAGCGGTGGGTCTAAATGGATATACATGTAATCGTATGTTTCTTAATTTTACTAGTAGC
TCAATAGTACTATCCGAGCTTCAACTGGCTACTGCAGTAATAGTAGAAATGGAAATCGCCAAACTACTGGCTACTATAATAATAGTTTTTGGTACAGCGT
TCAAAAGGCGGCACCCAGGTTTGGTAAGAGCCTTGTCCAAAAATAGAGAATCAAACATTTTTTCTTATCTATTTTTCCCCTATGAAAAACGAGGTGCCGA
GATTGCCTCTTTTTTAAAGAGCGAAAGTTTATTTGAGAAATGATGCAGAGAAGGAGGAAGTTGCTGTGGGCACGAAAGGCGCCTACGACGGCTGTCTGCG
CTCGGAAGCACCACCGTGTCGTTGGGGGGGTATAAGGACCAACAGAGAGCGCCTACAGATAGCAAGATTCAGCTGTAGTAGTACAGCGTCGATCTTCATA
ACCATTACACTACAGCGGCTGCAGCGGTCTTTTCAGTACACACACAGGCTCGCGACACGGAAGCACTGGAACGGAAGAAGGGCAAAGCCTCTTGGTTCAT
GAGGTACTAGCGGCCCCCATGACCAGGCCCTGGGTCTCCTAGTGTACTCGTCACAAGTTGGACCTTCCGTTCATGTTTTCTTAGCCATTACGTGTCCTCG
CCATAATCCTGTACCCCGACGCCCTCTGTATGCGAAGCGGTGCTTTAGCACTTCCACGTGAGCATGACGCCCCGCTCATCAGCTTTACTACCATTGATAG
CGATTTCCTACGGCAATGGGGAAGCTCGTGAGCGCGGCGTCGACTGCAAGGCGAACAGTTCATGGGCGCAGCGTCGCCCGCTAAGGTGGAAAAGCGCGTA
GGCGTGACGTCCGCCGTAGCGGGTAGTAAGGATAGAGCTGTGTGGATGACCTGGACTCCGGCTATGAGTGCAGCAACGTTACAGCACTCGTATAGCACTA
ATCCACAGATATCAGCTTTACTACCATTGATAGCGATTTCCTACGGCTATGGGGAAGCTCGTGAGCGCGGCGTCGACTGCAAGGCGAACAGTTCATGGGC
GCAGCGTCGACTGCCAACGTGAAAAAGCGCGTTGGCGTGACGTCCGCCGTAGCGGGTAGTAAGGATAGAACTAACGGTCTCAGACTACTCCACCGGACTC
GTGTAGAAACTATTCCAGGGGAAGTTCTAGGTTAAGGCCGAATGTGTGGATAACCTGGCCTCCGGCTATGCGGCGCAGGGCCTCAGCCTGAGCCCTCACG
TCGCGCCTGGTGTCGACACTACATCGACGGACAGAATGTAACTGCCGCCAAATTAACTGCCATTGCCAAAGATAAGAGCAATAAACAAGGATGGGAGGAG
CGTGCACATCTTCATAAAAGAACAGCAAATACAGTACTGCACCCCGTTTTCGCGGGGGTGGACCATATAGGATTTGCAAATAAACTAGATTTTAGCTTAC
AAATTATAGCTCATTTGGATTCAGGATCATGACATCCGGAAGTTTATCAAAGGTCCAAGGGCGCGAAAACGGGGTGCAGTACTGTACTTGGGTTTCAGCA
AATCAGGTATCACAATTAAACGCAATCAAACAATTTCTTACAAATGGTAGGATAATATTATTATGGCAATTCTTCATGGTAAATGTTTATCCAATCAGTG
CTGAATATTGTATATGGCCGTTCTATCATGTGCAGGTCCTTTTTGTTCTTAAAAACTCAAACCATTCGTGGCAGTTACATTCTGTCCGTCGCTGTAATTT
GAGATCTTTCTTCAGATACAGCCTATCAGAGGGGTTAGTATG