Description :
From Genome Similarity Track
Location :
Scaffold_115:3958- 5341
Sequence
1383 bases(100 bases per row)
TAATGATTTCAAGTGGTAATGCCCTGCCGCCTCCAGCGTACGGAGCATTGTGCGACATCGACGTTCAAGGACACGCACCTATCAAGCAGAAAGCTCGGCG
GATACCTCTCCGCCACTTGAGCAAACTGTACGAGTTGTTGAAGAGCCTGCTTCGAGCTGGGTTGATATCATTCTCGGGCAGCCCTTGGGCCTCACCAGTG
GTGATAGTACTAAAAAAAATGGTGTGGATATTCGGCTATGCATTGACTATAAACTAGTTAACGCGATTACGACGCCGATGGAATACGCCATGCCACTAGT
TGATGACCTGCTCACTGAATTGGAGAGTTACTTGTGGTTTTGCTCGCTTGGTGCTGAGAGCGGATTCTGGGCAGTCCTGTTGACTCGCCGAGCTCGGCAG
ATCTCAGCGTTCGTCTGTGCACTTAAGCGCTTTGAGTAGTTACGAATGCCGTTCGGATTGAAGAATGCGCCTATGATTTACCAACGCCTCATCGACAACG
CTCTATGGGGATACGTTCAACCAAAGGGAGGATGGCAGTTGTTTGCTGAACGAATGGCTAACGCCGAAGACGAGTCGGGAGCTCGGTGATTCGAGCTCGG
CGGAGTCAGCGATTCAACGCCAGGACAGCTGACAAAGTTCAAAGCGGACCACCAATCACAAGCTGACTGCGATCCGGTCCAAGATCTAGTCAACGGACCG
GACGGTGACATGCTCGCTAATGGAAAACCTGACCAGTCTTATTTGATCCCAGTGTTCAAGCGGAGGTCGTTTGTCAATGATATTTGTTTTGGAGGGGAGA
CGTTTGACGCCTGCTTGGAGACACTCGACCGACTACTAGCCCGGTTCACAGAATGTCGAATAAGCACCAGCTTTACCAAGTGTATCTTTGTCCAGCCCAA
GGTTGATTTCCTGTCGCACGAGATTACGCCGAGTGGCATCCGCGCTGATGCGAAGAAGATAGCTGCGATCGCCGAGCTCTCCATCCCGAAATCAAAGAAG
GGAATGCAAGCCTTCCTCGGTGCACTTAACTATTACGGCCGATTCATCCAGAAATTGGCTGTTTATGGAGCAGTACTCTACCAACTCAAGGACACGGACT
TTGGTCCTGGGGGTGACTTGAAATCAGCAAAAGCGTCATTCGCCGAGCTAAAAAAACGGCTCCAATTTTGCGCCATTTCGACTCGGCGAAAGAAGTCCAC
ATAATGTTGTATGCCAATGACTGGGCACTGAGCCGTACTATGATGCAGCCGCACGACGACAAGCTGCACCCAGTTCGCTTCTGCGGACGCGTACTAAAGG
AGAATGAACTCGGCTATCATCCCGCTGAGAAAGAAGTGGTCGCGCTGTTACAATTACTGAAAGTGTGCTACACTCTCTTGGCG