Description :
From Genome Similarity Track
Location :
Scaffold_242:39578- 42483
Transcript NameFunction/comments
Phymu_g7408P-type ATPase (P-ATPase) Superfamily

Sequence
2905 bases(100 bases per row)
GGTACAGCGTCGGGAACTCCAGCACGGTCTTCTTTGGCAGGTCCTTGTCGTACgccgagaagacgacgataGGAATCGCAGTGAAGAACAGATTGTAGCC
TTGCTGGACCAACGCAGAGTAAACCATCGTGCCAGAGTACGCTGTGGGCCAAAGCGTGTACCAGAACATGGACACGTTGTACGTAATGTTCTTGTAGAAC
GTGTAGACGACCAGAGCTGCCACTCGGTTGTAGTTCCACCGGCCATGGACCAAAATCAAGTTGCTGAGGAAGCGGAACTGGCCCAGCGCGTAGTCCGAGC
TGTTGACAGCTTGCAGACCCTCCTGCCCACTGATACCAACGCCAATGTGAGCGCTCTGGATCATCGGAACGTCGTTAGCGCCATCGCCAATTGAAAGCGT
GTGCGACTCTGGAACATTCAACTTCACTAACTCCACCAGCtgcgccttctgctgcggcgAGACTCGGCAAGCAACCACCACTTTGCACAACAGCGACACA
CGCAGCAGATGCAAGTTGTGCAGAGGATCTTCGAGGATCTTGCTAAGCGAAGCACCGTCAATAACGAGAGCATGTTCCACTTGGCCTGATGTAGGCGATA
GAACGGAATGAGCAGCTACAGTTGATGTGTGTGAAGCATCATCAGCTGCGTCGTGGATGGAGTGGAAGATCTTGTCCAGTTTTCGCAGAATCGACCCCTT
CGTGCGGTACTTGGCCGCGTTAATCACGTGTCTCTCCATGTCGTTGTTGAGCAAGCGGCAAGCATAGCCAATATTGATTGCCGTCTCCTCCATATCTCCG
GTCAGCACCCAAATGCAGATTCCAGCCTTGGCAAGCGCTTCCATGGTCTCGGGGACGCCATCCTGCAGACGGTCTTCAATCGCAGTGGCACCTAGCAGCT
CCAGGTTCGACTCCATCTGATCTTGAAGGTTGTCGATAGCGTTTGGCTCACCACGAGActtcgcttcaacttcactcAAATCGGCAGATACGTGGCGGTA
CTGGGCGTAGAACTGCTCCCACACGTGGGGGTTAATCTTTTTCGCGCACACAACCAGCGTACGAAGTCCGTCCTGAGCGAACGCTTCTAGGTGCTTCTCT
GTAGATTCACGAATCTGCAAGTTGTTCTCAGACACGGGGGCCAAGCGGGGGAACAACATGCTGTCTGCTCCCTTCGTGAGCAGCAAaacgtcgtcttctt
cactctccGACATTAGGCGAAGTTCGTCGTCACGCTTCCGACGCTGTACAATCACCGACATGCGCTTCCGGTTGGAGTCAAACTCGAAAACTTCCAGGAT
ATCGTAAACATCCACAACGCCGTTCGGTTTCTTGATTGAGACGTTACCAGGCTCGCGGTCCATGAACTCGTAGCCAAAGTACTTCGCGCCACAGACCAGG
GCCAGCTCATCTGGGGATGAGGCCGAGTAATGAACAGGAGGCGTTGCGTCATCTTCAGTCGGATCAAGACGTTCGATCAGGACTCCGTGGCACAACGCTA
AAAGAGTCATAAACTCTTCAATTTTCCCGCTTTGAGTGTCATTCTTGTGCATGTCTCGCCACATCGTCTTGTCCTTAAAGTTCACATTGGGGGCCGGCAT
CTCCATGCGAGCATCCAGAAGCGGGATGTCGTTCTCGTCCGCGGATTCCTCCTCTACGGTTCGGTCGCCCTTGAAGTCATTGCGcattcgagcagcaaga
ccGATGGCCGTCGTGCCCTTGCCGTAGCTGCGGCCGCCAATACTGCACTTGCGGAACTCCATCTTGTTGCACGTGAGGGTGCCCGTCTTGTCCGAGAAAA
TGTGCGAGATCTGGCCCAGTTGCTCGTTCAGCTGCATGTTACGCACGTTCATCGGAGTGCCGCTCTCTTCATCGTACATGTCGAGATCGCGCTCCATGAA
GTATCCTTGCAAGGCCTTCACAAGCGTAATGGATACATAGAGAGTAATAGGCACCATGGAGGCCAGCGTCGCGAAGAAGTACACGAACGTCTCGATGAAA
GTGTCGTCCCAACCGTCCAGGTGCAGATACGTCGGGAGATCTAGTCCGTTCATCCACACGCGGTCTCCAGTGGCGCCGATCAGCGACATTAGCACCAGAA
TGATGACAACAACGATCACTTGTTGGTTGGTCATCTCGTCGATGGACGACACCTTCACGGGAAACTCATCGCCAGAACTCATCATGATCTTGCTGTCGAT
ACCAGTGTTGACGACCAAACCATAGACGAAGCTAGTGTTACGCAGCTTACTGCCGCGAAGCAGCATATTTTTTAGCGTAAGAGGGACGCCGTCCGCGCTG
CCTCCATTCGGGTTCTCCTCCAGATACATCGTACCCGAGTACGTGTTGATATCACCGTTCGGAAGCTCGCTCTCGACGTACCCTTGGATGATGTACcccg
cttcctcctcattCATAAACATATTCCGGGTGGGCTGCGGTGCCTCTCGCAGCTTGAGGTTCGTCTCGCCATCCAAGTTCTTGGTTTCCACGTAGCAGAG
CCCCATGTTGCCACCCGAGCGAGCCCCTTCAGCAGGAATCACAGCCATAATCATGATGTCGGCCGGTAGGATCTCGTGGTTGGCCACCTTGACGAAGTCC
CCCACCTTGATATCGCGCCACTCCACCTCCTCGAACTCGCGCAGTTGGCGGTTGTATACTCGGGTCTTGGCTGAGTTGGCGAGGTCATCGGCCATGTGTC
GCTTGTAGTCTTCGTATCCGGCGAAGATGGCGTCAATGATAATCACAATAGCAAGAGGAATAAACTGGAGAGGAACTCCGTCCGTGGGGGAAACGGACGG
GATGATCTGGAAAATACCGATGAGCAGGAAGTACAGGTTGGCCGTCTTCTGGAACGTCAGATACAGGAACACAGGCAcgaagctccaccacgtgTACTGC
GACGT