Description :
From Genome Similarity Track
Location :
contig_47:395755- 396765
Transcript NameFunction/comments
g7902.t1hypothetical protein

Sequence
1010 bases(100 bases per row)
TGCACGCGCAGCTCACGCGCTTCTCGGCGCTGCCCGATGCCGAGATAGTCGAACTGCTGCGCGTGCTGTCCGAGTTCCTCATCTACTCCGACCAGCACCG
CGTGTCCGTGGATCTGGGGGACCAAGCGGAGGCGGACGACGCCGGCTCCTTCTTCGACTACTTCGGAGAGACTAACATGCTCGCGCTGCTGGTGGAGCTG
GGCGCCAGCCAGCCCAGCGTGCCGGTGCAAGTGCAGCTGCTGCAGACCATGAGTATATTGGTGCAAAATATCGCAACGCGCACGTCGCTGTACTACATTC
TGAGCAACAATCACGTGAACCGCCTGCTGGAGTGTCCTTTTGTAGTGGACAGCGATGACGACGTGCGGGACTGGTACGTCACGTTGCTAAAGGCCCTGTC
GCTCCGGTTGAACGAGGAGACAGTGCAGTTCTTTTTGGACACGCAGCACGGAGACGACTTCAGCTTCCCGCTGTATGCGCGCGCACTGCGGTTCGGCAGA
TGCAACGAGACCATGGTCAAGGTCGCGGTCAAGACGCTGACGCTAAATGTGCTGAAAGTACCGGACACGAGAGTGCGGCGGTTCGTACTGCAGTACGACG
ACCTCAACTGCTTTCGGGATATTGTCGAGATCGCGAACGACTTGACGTTGAACTTGCAGGGGCTGCTGAACAATTGGCCGACGTCGGAGGACAAGGTGGA
ACGGACGGCGGGGACGGAGAAGCTTGAGGAAGCAGTGGACGCGTACATTGACCACTGCTTCTACCTACAGGATCTGCTGGATGTGAATGTGCCGGAGCTC
TGCTATAAAATTGGGGACTTGCTCTTTTCACGGCATATCAAGAGTTTGCTGGCTACTAGCATACTACCGGATTGCGGACCGCCGCCACAACGAGTTTCGA
CACAGTTGGCACTTTATTTACTCACAAGACTGTTGGGCATCTTGGAGCATGCACCTCTCGTAAATGCAATAGCCTTCATGTTGTTGTCGCCTGATGCAAC
CGAAGACTGC