Description :
From Genome Similarity Track
Location :
Scaffold_671:3957- 5617
Sequence
1660 bases(100 bases per row)
GTGAAGGCGTAGCTCTTCTCGGACGAGCCACTTCGGGTAGCCTGTGCCCTGTCCAACATTGGTGGACGTGCCAAGCACTGGACATACACCAGGGAGATGA
CATCTCATGGATGCTTTGCATTCTGGGCTCAGCTGTGTGAACAGCTTCGAGTCGCGTTCCTACCGACAAACAGCGCGTTCCACCAGCGCTCACACTTTCT
CGTATGTAAGCATGGTAGCCGTGAGCCGAAGGAGTACGTGCAAGAGATGCGCACGCTGGCGGTATCTCTAGCAGGGAATCATCTGCCTGAAGAAATCAAG
ACAACAAACTTCATGGACGGCATGAAGGTCGGTCCTGCTCGCACCCAGCTATTTCGGGTGCAAGCGACAACTATGGAGGAGGCGATTGAAAACGTCCTTC
AAGAAAAGTACAGCCACACGCAGGCTGGTACACCTCAGAAAGAGGAACATTGCCACGATGAGGATGGTGCTCCTCGAGAGTCGGGGCATCGCAGCAATGA
CACTGTTTATCCTGCTGTCACGCAGCCCGTTGATACCGGTGCGTACAGCGAGTCCAAACCCATGGACTTAAGCTCGATCGAGAGCTTGGTCCGCTGCTAC
GGATGCTGTGGCCATGGACACTACCAGCGTGTATGTCCCTCGCCAGCCCTCGGGAAGAAGACAGTACATGAACCCCAAATCCGGTTGTGCAGGTCATGGC
TAGGTGGACGACGACTCCCCGACCAATAGTAGAGGTGGTATGACATACTGAAGAGCGCTAAGGCTTCGTGATGGGTGTGCAGGCTGTGCGCACCACAGGA
CATAGCCCAGAGAGACGTGGCTCTCTCAAACCGGTGAAGGTAGTACACTCGGTTTACGGGGATACGGTACCCCTTGATCGTCGGATAAGTTCTGAAGCGC
TGATACGCCGCCGGAACGTCGCTTGGCATAGCGTCCCCGACTGCACTATATGTCAGAGTGGCTGGTTCTTGGTGGACTAGCCTTTGGTACGGAGAAGGAA
ATACCAATGGTTCTCAACGGACCGGAACGTCTGGGGTCGATGAACTCGCGCACCGCGGTATCGCTCGCAGTTCTCGCCATGAACAACGTGGCTGTGCCGA
ACATAAGGCACAGACCGGACTTTGGTGTGGTAGGGCTGAGAATGGACGCCCAGTCCAGGTCTATGGCGGAGCATTAGTGAGTCATGTTCCCACCTCCGTC
ACGCCTTGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCTGGACGCAGAAGCGTCACGGATTGTCGACGCGCCGACAGCTCTGTGTACAGCAAGACCATGCTCCGCTGCGGCAATGTCACGGACA
TGGATGCTTTGCCCGGCGTGTGGACCGGCTACACCAGCAGCACCCGACACCGAAGGTCGTCGTGCCGTACGGGCTTTGACAGTTGTTATGCCTATAAGCG
CTAGCCAGTAGGATCACACGGTCGCCCATATCTTAACTGAAGCGGAAGACGCTGAATGCGCTTCCTGTGTGGTTAGCATAGTACCACACACAGACGCCCG
GACTATAACTGAAGAAGAAGCCATTGATGTGCTTCCTGTGTGGGTAACATAGTACCACGC