Description :
From Genome Similarity Track
Location :
Scaffold_1103:3957- 5321
Sequence
1364 bases(100 bases per row)
CAACGGCGGTGACAGCAGCCCCCCATGTCTCCACTGGGACCTTCGACATTGGCCGTCTTCTGTGGCTTGTCGTATTGTTCGGGGGTGGGCGATCGACGGC
TTATTCGAAAGCTGGATCCTTCCCCATTCTTCTGGGTGTCCTCAGACCGGCCCAGGACTTTCATTTGCGATGATATCTGCCGACTAAAACATGACCAGTT
TTCTCTTAttgacttgaatttgtataCCGAGCAAGTGGTCCGAAATATGTCCGGCACGGATACCTGATGGTGCCGATGCATCCGTTCCTCATCTATCGGT
GGAAATGTGCTTTCTCGATGGCCCTGTAGGTACGGGAAAGTCGTTCATCCTTAAAGCGATTCTGGCAAGTGTCCAACGCACTGAGCGAACTGCCCTCGCA
GTCGCGAGAAGCAGGATTTCTGCCGGCTTCATTTTGGTGGACTACGGCGCACTCCGCATTTCGGCTCCCATTAGACCCTGACGAGACGTCCACTTGAAAT
CTTGGTTGGTGCTATCAGGTGATTTCAGACAGACGCTTCCGGTAATTCCGAGGGCTGGACCGGCTGAGGTGATTTCTGCTTCTCTGAAACGCTCCGAACT
GTGGAGAAGCTTTCAGTGTCTGCGCACGTCTATCAACATGCATGTGCGGACTGCTGTCAACCTAGACACACCATAAGATGTGCAAGCATCTGCAGATTAC
CTCCTTCGACTTGATGACGGATACCATGAAGTTTCCGCGGGCTTGGATAGAAATTCGTGAAAATACCGAACGACATGCTTTTAGAAGTATCCAGTGTTGT
GTCGGCTACGGTTTCGGAAAGTCCTACCCGAGACACAGCGTCCAGTAAACTTCCACTGTCAATTGACAGCGTGTACGCAGATTTCAATGGAGGTAACCAA
CCAAACTGCTATTTCTCCGACATAATTATTTTGACACCGCAGATCTCAAACGTTCTAGCGGTAAATGATATGATCCTGGAGAAATTACCTGGGGTTGCCA
AAGAGTATCGCTCGGTGGGTAGTCTCGATGGAGATGATGAATTGGAGCGCCAACAACATCGTGATATTTACCCCCCGGAGTTCTTGACACAATATCACTG
AGTGGAATGCCTCCCCACAATCTGAAATTCAAAATCGGGACTCCCGTGGTGTTGATCCGGAATCTCAATAGGAAGGAAGGACATTGCAACGGAACTTTAC
TGAGGGTTGCGTCTTTACGTCGGAACTGCATGGTGGTTGTGATTATGGGCGGATCATTTGTCGGCAAACGCGTCAACATTCCCCGGGTAGCGCTGATTAG
CAAAACTGAGGATTCCCATTTGAGTTGCGAGAAAGCAATTTCCTGTGCAAGTGACGTTTGCGCT