Description :
From Genome Similarity Track
Location :
contig_5:3957- 4960
Transcript NameFunction/comments
g1602.t1POM81867.1 Transposase [Phytophthora palmivora var. palmivora

Sequence
1003 bases(100 bases per row)
TGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAAAGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGGA
CTTTGCGCACACGTTTACGGCGTCCACAGTGCGGGCGCGACGCGAAAGGACTTGGTGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTC
AGCACGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGCCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTAC
CACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACCCTGGCGATGATGGCCAAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACT
GTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAACAT
ACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGCT
GAGCAACTCTGCACAATCACTACTGAGAAGTAGGTCGGCTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATCG
CTGTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTGA
AGAGGCCATTAGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGCT
ACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACTG
TCC