Description :
From Genome Similarity Track
Location :
Scaffold_138:39567- 46539
Transcript NameFunction/comments
Hyaar_Emoy2810816peroxidase BpoC

Sequence
6972 bases(100 bases per row)
AGCCCTTGCAACGGACGTGGCAAGTGACGACTGTTTCTCGACGTCGTCGACGATAACGAGCGAGAGCGACTACTGGACGTCGGCTCTCGATCCGCTCCTT
GTCAACGAGCGACGCCACATGGCTCCACTGCAGCCAGTACTCGGTCGCTGTGCGAGCTTAGGTCCACTGATGCACGCGCGCGTCAAGATGCACCGCGCAC
GTACAAGTCCTCAGCTACAAGAAGATATGTACGCTGCCTACTCGCAGTCGCCGTGGAGTTCAAAGCACGGCAAGTGTTCGTTTCCGTCGCCTCAACGAAC
AACGACGGTTATTGCAGCCTCTGCGAGCTGACTAGCCGCTGTTAGAGCAAGTAGACCACAGCGTGTCGGTTTACTTGTGGTCGCTGATGGCTTCGCTAAG
TACGGTTCAGCGTCGTTGGCATGTTGCCCTAATTTTGACTGATTCGCCACTAGGGTTCCTATTTTTTTCTACGTGACTACGAAAACCGAAGCACGACATA
AACTTTGCCCCCCCCTCAACATTCGTACACTTGAAGTATTTTACTCTCTGTTGGCTCCAAAGAGCGTTTATTCACGCAAAAACAAACCTACATTAATCAA
TTTCTTCCTTGATCCACGTGCTGATACCGCGCTTCAGATTACTGTAGTAATACTTGCCAGGCACACTTCGCGACTCACGCTTGACCCAACCAGGAGGAAG
TTTCTCCACGGTCTCGGGGTACTCCCGCTGCTGCTGCGCACGCTTTACCATCTCTTCGGGATGGAAATGACAAATCTCCTTAAACATGAGCTCCTTGAGA
TCCGACTCGTCGAGATCATCCAAATCAAAACTTTCAAACTTCTCCACCGGCACATTCGTGCGCTCTTCATCGTAATACATGGCCAAATAAGGATGCTGCA
GCGCCTCCTCGACACTAATACGCTTCTCCACGTCAAACACGAGCATCTTCCATAACAGGTCCAACCCTTCAGGATTTGCGTTCGGGAACATGGTGCTCGT
GTCGACTCCAGCCACCGCCTGAGTTCGGCTCAGTAGTTGACGGCCCTTCAGCTTGTTGGCCAACGGATTCTCTTTGAACGAGTGCTCCTCCGGCACGCCA
AGCACATTCATGATAAGCTGGAGCTGGTGGACATAAGTCTCACCGGGAAACAAAGGCCTGCGGCTCAGCATCTCGGCAAAAATGCACCCTGCCGCCCAAA
GATCCACACCTTCGCCGTAAGCACTACCCAGCAAAAGCTCCGGTGCACGATACCAGCGCGTTACCACGTACTCGGTCATACCCACGTCATCCGCTTCCTT
TGACCGTGCTAATCCAAGATCGCAAATCTTGAGCTGACAATCGGAATTGATTAGCAGATTGCTGGGCTTCAGGTCGCGGTGCAGCACACCCGCACGATGC
ATGTGATGCAAGCCGCTAAGCATTTGGTACAAGAAGTAACGGATATGGTCATCACGTAATACCTCCTTCGAGTAAATAATGCGGTGCAGATCCATTTCCA
TCAAATCCACCGTCATGTAAACGTCACGGAAATCGGTATACGATGGCGGTGGAATCAAGTCCAGCAAACTCAAGATATTTTCATGAGCCATGTGTCGAAT
CAATCGGCACTCGCGCAAAATCTGCTTGAGTTGATGTGGGTGCCATATACAGTCGATGACCTTTTTAATCGCAACGTTGCCACCCGTCCGCAAATTCGTG
GCGGCAATCACAATACCATAGGCACCGCGGCCGCATACTTTAATGAGCTGGTAATGACGCGGAATCGTGAAAGGGGCCCCGCACACCATGAACGTGTGCA
TGCCAGCATTCTCCTTACATACAACAGCGTCTGTTGCTGTTGGTAGTGCTACACCATTTCCCTCCCCTGAAGGAAAATGCTTGTTCACTGTATCGTCTTC
ATCGTCCTTGCTGTACTCACCGCTAACAATGGCACCCGCCGATTGCGTACGGGCAGTGTGCTCAGGAGAGAGTTTCACGTTCGCCCAGCCATGGCGGCGC
GCATGTTCGCTCCCACTCGGTATTTCGTCCAGCGTCATACCCTTTTTGAGTGCTGGAGTTGCCGCAGCACCCAACAACGGTAGTGAATGAGCTACTGGAG
TGGCATCCCATTGCAACATATACGATGACGGAGGATTCTTTCGGTCAATCACGACGCTCTGGCTCTTGTTTAGTCGCGGCTGTACGCTATCACCCTCGTC
GAGCTTAACGCGTCGGCAGGTAATACCAAGCTGGACCTTACCGCAATATTCACCTTTCGCGTTGCTAATCGAATACCATTTGCTATCAGCTGCCATAGCC
GCCTCTTCCCGCTTCTTCGTGCGCTCAGAGCTGTCTGCAGCCATCAAGTATTTGGCCACGTTTAGCGTAGCGAAACCAAGCTGCGATTCGACCCCGTTCT
TCGAGTGATCTTTTACGTCCACCACTAGCGAGCATGTGCCGATGACATCACTGAACGGGAGCTCCAGCACCAGATTCCACACCGGGTGAGTCGGCAAATA
CGATTCGTCTCCAGTGTTGCGAGGAGTACCGGTGCTTAATAAATCTACCACTGGAGTCGAAGTGTTGAACGTAGAAGTGTTCATATGACCAACACCAACA
CCAACAGCAGAAGACGCCGCCGAAGCGGCAGAACTGGCTACGGAGGTCATAAAGCTAAACTTCCGCGACAGATTCGGCATCGTGATTCCACCGATAAGTG
TCGACGAGCCCACTAAAGCGGACGTAGACGAACTTAATGTGGACGCACTCAACATTGACTTGGGCTCAGGCTGCTCGCGGTACTGTAGCCGCACCGTAAT
GCTCGGGTCCTTAACAATCTTCTTTACCGAAATACCTGCCTTGAGTCCATGGCCCTGCATGACTCGAACAAGCAATACACCGTCAAGGCCGTGCTCAGCG
TCCACCTCGTTATATTCTTGCGGAAGTTTAAGTGTCGTCGCTGCACCAGGGACTTTGAAAACCGCACTTGCTGCTACGACGTCGCCATTGATCTCAAATC
GCGCAAGTCGTCCATCTGAATAGAATGTGAACTTGTGTATCCAGTTCTGGACGAACTTGCGCGCATCACGCCGATTCTCGAGCTCCTCCTTGCCTGACGC
AACAGCGATCGATCCATCGATCGACATGCCACCAATCTTGAAGTTGGTCCAAAGCGTATGCCGAGCAAAGTCATGCATAAAAGTCACGACGCCAGCGTGG
CCGCGGAACGATCCGTGAAATGGCACTGACGGCGGATAGTTCGAGCAGAAAATAACATCCTTATCCAACAAACGAAAGAAGCGCGTGAACACTTGCTCTG
ATGGCGGAGGAAGCGTGACAGCCATGTCGCCCTCCGTTCGCCAATTGCCACTGTGGGCCGTATAGAGTACCACCAACATCGCATAGAATTCTTCCATATC
AAGCGGTGCGACAGGAAGTGTAGGAAGCGCTACTATAGCTTCAAGCCCTAGTCGCATCCATATAATTTTCTCCACGGCCGTTGGGGCTGTCACCTGCAAA
GTCTTCTTATCTTCTGTAATGAAGGTGAACCCGTTCGCACGACTAGACGAGTCCTTAACCCCCGCTAGCACGTACAGATGACTCACACCGCTGGACGCTG
GACTGCTAGAGTTACGCCGAATCATACTAGCAGCAGGGCTGCCAGGTGCAGGCTTACCCGGATCACTTGGTGGCTGGATATGGTGAGGCACAAGTGGCTC
GTCTCTAGACGATAAATACGCCTCTTTCGACGCAAACCTTCGCAGGAACTTGCCTTCGAGTACGTAGTAGTGTCGCTCCAACCTCCTCAGCCACTCACTT
CGTCTCGTCAATACGCCTTCCCATTTCACAGCTTCATGATACAATGTTCTCGATTGCGGTCGAAAGCTAGAATCCCGCTCATCCACTCCTAACGGCGAGT
GCACGCTCATCTCTTCATCAAGATCCAACATTGGCCTGTCTCGATTCAGCATTGGATCCGTATCATCATGCGTCGACACCATGTCCAGCACTTCTGTCTT
GTCAATTGCCTCGTCGGATCCGTCCTCCGCACACTGCTCGACGCCACAACCGTTACTAGTCGCAGCCAAGGGGACCGTCGTGCTGCCCATAGCTGTTGCA
GACGACATCCTCTTTCCAAGTGTGTTCAGTCGAGGATCATGAGCCTCGGACAACCGCCGCAACGATGCATTGTACAGATTCTTCTCCTTCCCATGCAGCG
ACAGCTTGGCATCCTCTAGAATCTCCGACGCCCGTTCCGATATCTGTCCCTGTTGTCGCCACATATTGATCACGCCTTCTCGACTCGCCAGCACGACGGT
CGTGGCCATCGAGACGCTATCGTGACTGCGTCGACGGTACGTCACGTCCTTTCCACCTGTCACGGTTGCCACATCCAGTCCATCGATCATGTCCAGTGCA
AAATGCGACAAGCAGCTCTCACTAGTCCGCACAATGTGGTCATAATGGGGCTCTTCAGGTCCTCCCGGTGTCGCGAGACAAGACACACCATCTGCTGTAG
CTACTGCTGCTGGAGTCGCCGCCACGTCGGCGTCGTCCACAGCCGGAGACGGCCGCATCCGTAGCGACGCTCTCGTCCACGCGGCACTTTCTGACTGCGT
GCGCAGCCGCTCCTTCCGCTTCAGTCGCTTCAACTTGGTACAACTGGGCAGCGAATCCACGGCACTCAATGGGCCAGTAGCTCCGAGGTCTGGATCTGCT
GGACTTGTGCTCGTAGACGACAGGATACTCGCTGGCTCTTTGTACGGTACCGTGTCGTCGTAGCCGTCCAGCTCTTCTTCGGTTGGGGACATTGCGCTCG
TGTCCATAGCGGCGTTTGGCTCGTGTCGTGTGTGGCTGAAGTAGCTGTTACTTTAGATTCTATCAGCGAGTGTGTGGTGCGTGTTGCTCGAATGTACCGA
AAGCCAGGCGGGCGAGACAGACACCCGGCCCCCCTTACACGACGCGCGAGGGAGCGCAGGAAGGCAGAGGAAGCGCGTCAACGTACACGGAAGGACGTGC
AAGAAGGGAGGGGAAGAAGATACGGAGACGAGTGCGGCACACGTGCGCTCGGAATCGGGCAAGGGTTTCTATTGACACTGTCGTGCGGTTGACGGGTTTC
TAACCGACTTAGAAACGCGTGGCACAACGTCAGCAACTCCCGTCACGGTCGTCTGTTTGTAGCGGAAACAGATGGCAAGATCTTAGCAGAGAAACCGACT
CTCGCCTTGTCACGCGTGGCTGAGTGTCGAGTAGTCCTGGGCTACATGCCTCTTTTATGTGCACACCGTCACGGCTCTGTCACCTTTATTCTTGAGCCAA
GATTGGCGGGAAAATCTTCTGCTGGATCATCTCTTCCAGCACCGCGCGCACCTCCTTCGTCTCCAGCTGCCACAAAGTATCAGTTATGAGTCTCGATAAC
GCACACAGTCCGTGCATTACAGTTGCATCGCACCATGGGGTACTCGTATCGAAAGCCTGTTGACTCAATTTTAGAACCGTCCGCGTAGATGTGATTGTGC
TGCAGCAGCTCCTTGTCGATGTAAGGCGTCAGCGGCGTGTTAGTGATACCGTGATCCTACATATACCAGACCATAAGTCAAACAATACAGTATACAAAGG
CCGCAAGTGAGCTACAACGACACGTCAATGATAGAAACGATTGTAAGGAAGGGAAGAGCGTACCGCGCACAGATCAGCCCAAGGCTGCATGTGCTTGTCG
TTGGCATCATCTACCACGTCAGCAAGTCGCACGCGGGCTAGGTTGGACACCAGCTTGCCAATGAAGCCTGACTTGATTTGGAAAATCACTTCCAAAATAG
CGTTTACCTTCGCCTGGGCTGCGAGCAGTACAGAGCTGTTAGTGCAAGTAGACGGGCAACAGAAGTGAGTACATGCTGCACTTACTCGTGTCATTCTTGT
CGACCAAGTTGTAGATTTCACCATCGTTTCCGGCAGTCGTGACATGCCACAACGCTTGGCACACATCAAGCACGTGTACCTGCTCAAGCAATGCGTTTGT
CAGGAATTTGTTCTGATTTTGAGTCACGCAATGCAGCAAATCGCACCGTGTTGACACGCATCTCCCCGTCCCACAGCAACTTCATCTTTTCTTGCAGCTT
CACATATCTGAGACACGGTAGTGCACCAAACAGGTCAGTCGCGTTAATCCATTAATATTGTACTCAGCAAGCCACACATACGAGGCAGCACAGACAATCC
GCGGCATGAGTCCCATCGAGTCTGCCGACCCGTACACCTAGCGCATAATCAGCCAGGTATCCCCGAAAGAGTAAGCGACAGCAGTCGACATATTGTCCAT
TCATGCAACATACCGTTGCCAAGCGAAGGAATACAGCCTTGAGGTCCGGCAAACGACGAATCTCCTCTTCAGCCTCGAGTTTGTACTTGGCCTGTAAAGT
CCACGGCTGGAGCTCAGCGTCCTCCTTCGCCGGCTGCTTGACCTGCGACTTGTACACGAACGCCGTCGACACTTCAACGTAGCGCTTCACGCCAAGGTCC
TGTGCTTTCTTGGCTACCAGCACCGAAAAAAACGTCGTTTCAGTCAGTACACATCCCCACAGAATGACAGCAATCACGAGACAATCGGCAGCCCAGTAGC
TGCCTCTCAACCCATTTGCAGCTCCGAGTCCAGACGTACCGCATTTGACGGACAGATCGCGGCATTTCGAGGCGTAGACGGTCTCGGAGAGTCCGCACTT
GGACTCCCCCGCGAGGTTAAACACAAAGTCGTAGGGACCAAAGTCCGGGTTAAACGCGCGGTCCACGTGCGCGTCACGGGTCAGATCCGCTTGGACGAAC
GTCACGCGCTTGTCAGAAAATGCCTGTTTGTGTGAGGCGCTGCCATACGAATAGAAACACCACGAGACGGTCACCACACATAAGTAAAGAGAGTCAAAGA
GAGAGATGAACCAGAATATGACGTCAAAAACGCGTTTGATTCGCACCTGAAGTAGGCGATCTCGGGCATCGT