Description :
From Genome Similarity Track
Location :
contig_5:3956- 6889
Transcript NameFunction/comments
g1602.t1POM81867.1 Transposase [Phytophthora palmivora var. palmivora

Sequence
2933 bases(100 bases per row)
GTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAAAGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGG
ACTTTGCGCACACGTTTACGGCGTCCACAGTGCGGGCGCGACGCGAAAGGACTTGGTGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCT
CAGCACGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGCCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTA
CCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACCCTGGCGATGATGGCCAAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCAC
TGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAACA
TACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGC
TGAGCAACTCTGCACAATCACTACTGAGAAGTAGGTCGGCTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATC
GCTGTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTG
AAGAGGCCATTAGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGC
TACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACT
GTCCTTGAACATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTATACCAGTTGCATCC
ACTGCTGCGGTTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTCAGATACTAATTCAG
TGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCCACTATTGCCAAAGC
CAATTTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCATGTGTCGATTGTAT
TGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAGCATTGGTAACCATCATCA
CGGTATTGCCATCGCACCACGACGCAGCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTGCTCCTTCTGGAGAATAGT
GTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGGACGCTTGTGTAATAGTTG
TCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGAGCTCCTCACGAAGCTGCT
GCACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAGTTCAAAGCGATCCACGTGGTCGAGCAGCA
CAGCACGTACATACGAAAATGATACTTGCCGCCAGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATGGCGGGACCGGCATGCGATACTCGCTTCGT
CAAGAGCCAAGTCACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTAATTCGGGCTGCTGGGTCTCGTTCCACAGC
CGATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGTCCAAGCTGGTAGATGCACCACCAAAAATC
GCATCTTCAGTCTGTGGCCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGATGCCGAGGAAGATCATCAGCTCTTCCATTG
TAAACGGCGTGGTGATTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAAAAGTAAATTGGAATGTAAGCGAAGAAGCT
CGAAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGTGTTCATACAGATCCGTGGGGCCATCTATT
TCCACATCTGGCTGAAACCGCATACTTTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTCTGGATCGTACATTTCCATACCGTCGTCGC
CTGACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAATTCACGCCACGCCGGCTTGTTGGGTGAGCG
CGCGAGAGCCTGGTAGTTCTCGATCCCACGCTGAATTACTGCCACAGTCAGAGTTTCAACTGCATTCTGGAACTGCGTATCTAGCCAAATCACTTGTAGT
ATCCCTCCCTTCTTCGTCGTTTTGACCTGACGACACACACGACCGACAATAAAGGCTCTGTCCACGCATCTATACACCTTTTCCTTCATCCACAATTCCT
TTGACGGTGAAAATGCCACCAGCTTCTTTAGTA